Human TMPO(Thymopoietin) ELISA Kit

Human TMPO(Thymopoietin) ELISA Kit

To Order Contact us below:

Human Thymopoietin ELISA Kit (TMPO)

RK02407 96 Tests
EUR 521

Human Thymopoietin (TMPO) ELISA Kit

SEC824Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit

SEC824Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit

SEC824Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit

SEC824Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thymopoietin elisa. Alternative names of the recognized antigen: TP
  • LAP2
  • CMD1T
  • LEMD4
  • TP5
  • Splenin
  • Lamina-Associated Polypeptide 2, Isoforms Beta/Gamma
  • LEM Domain Containing 4
  • Thymopoietin-related peptide isoforms beta/gamma
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thymopoietin (TMPO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Thymopoietin (TMPO) ELISA Kit

abx516010-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Thymopoietin (TMPO) ELISA Kit

abx516012-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Thymopoietin(TMPO)ELISA kit

GA-E0838MS-48T 48T
EUR 336

Mouse Thymopoietin(TMPO)ELISA kit

GA-E0838MS-96T 96T
EUR 534

Rat Thymopoietin(TMPO)ELISA kit

QY-E10460 96T
EUR 361

Mouse Thymopoietin(TMPO)ELISA kit

QY-E21460 96T
EUR 361

Thymopoietin (TMPO) Antibody

abx028266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

abx028266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thymopoietin (TMPO) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Thymopoietin (TMPO) Antibody

abx030767-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

abx030767-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Thymopoietin (TMPO)

  • EUR 445.86
  • EUR 222.00
  • EUR 1396.96
  • EUR 532.32
  • EUR 964.64
  • EUR 361.00
  • EUR 3342.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42167
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thymopoietin expressed in: E.coli

ELISA kit for Human TMPO (Thymopoietin)

ELK4922 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thymopoietin (TMPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thymopoietin (
  • Show more
Description: A sandwich ELISA kit for detection of Thymopoietin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thymopoietin (TMPO) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Thymopoietin (TMPO) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.

Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)

APR03096G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:


ELI-04132h 96 Tests
EUR 824

TMPO ELISA Kit (Human) (OKCD02937)

OKCD02937 96 Wells
EUR 831
Description: Description of target: May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope. Possible receptor for attachment of lamin filaments to the inner nuclear membrane. May be involved in the control of initiation of DNA replication through its interaction with NAKAP95. Thymopoietin (TP) and Thymopentin (TP5) may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL

TMPO ELISA Kit (Human) (OKEI00289)

OKEI00289 96 Wells
EUR 767
Description: Description of target: May be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly. Plays an important role, together with LMNA, in the nuclear anchorage of RB1. TP and TP5 may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

TMPO/TMPO Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

TMPO / TMPO Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Tmpo ELISA KIT

ELI-04131m 96 Tests
EUR 865

Mouse Tmpo ELISA KIT

ELI-04134m 96 Tests
EUR 865

Thymopoietin Antibody

25390-100ul 100ul
EUR 390

Thymopoietin antibody

70R-6297 50 ug
EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

Thymopoietin antibody

70R-6298 50 ug
EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the middle region of TMPO

Thymopoietin antibody

70R-6387 50 ug
EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

TMPO ELISA Kit (Rat) (OKEH03323)

OKEH03323 96 Wells
EUR 662
Description: Description of target: Binds directly to lamin B1 and chromosomes in a mitotic phosphorylation-regulated manner. May play an important role in nuclear envelope reassembly at the end of mitosis and/or anchoring of the nuclear lamina and interphase chromosomes to the nuclear envelope.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.4 ng/mL

Thymopoietin Blocking Peptide

33R-2506 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6298

Thymopoietin Blocking Peptide

33R-6275 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6297

Thymopoietin Blocking Peptide

33R-7041 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6387

Polyclonal Thymopoietin Antibody

APR06736G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Thymopoietin . This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TMPO antibody

70R-20884 50 ul
EUR 435
Description: Rabbit polyclonal TMPO antibody

TMPO Antibody

32699-100ul 100ul
EUR 252

TMPO Antibody

DF6994 200ul
EUR 304
Description: TMPO Antibody detects endogenous levels of total TMPO.

TMPO Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMPO Antibody

ABD6994 100 ug
EUR 438


YF-PA27383 50 ug
EUR 363
Description: Mouse polyclonal to TMPO

Human TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMPO Recombinant Protein (Human)

RP032329 100 ug Ask for price

TMPO Polyclonal Antibody

46756-100ul 100ul
EUR 252

TMPO Polyclonal Antibody

46756-50ul 50ul
EUR 187

TMPO Blocking Peptide

DF6994-BP 1mg
EUR 195

TMPO Conjugated Antibody

C32699 100ul
EUR 397

TMPO cloning plasmid

CSB-CL023913HU-10ug 10ug
EUR 492
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca
  • Show more
Description: A cloning plasmid for the TMPO gene.

TMPO Polyclonal Antibody

ABP57555-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody

ABP57555-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody

ABP57555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody

ES8548-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMPO Polyclonal Antibody

ES8548-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-TMPO antibody

STJ25881 100 µl
EUR 413
Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Anti-TMPO antibody

STJ98661 200 µl
EUR 197
Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein.

TMPO ORF Vector (Human) (pORF)

ORF010777 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Anti-TMPO/Lap2 Antibody

A03278 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat.

Mouse TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TMPO shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMPO Recombinant Protein (Rat)

RP233936 100 ug Ask for price

TMPO Recombinant Protein (Mouse)

RP180017 100 ug Ask for price

TMPO Recombinant Protein (Mouse)

RP180020 100 ug Ask for price

TMPO Recombinant Protein (Mouse)

RP180023 100 ug Ask for price

TMPO Recombinant Protein (Mouse)

RP180026 100 ug Ask for price

TMPO Recombinant Protein (Mouse)

RP180029 100 ug Ask for price

TMPO Recombinant Protein (Mouse)

RP180032 100 ug Ask for price

TMPO sgRNA CRISPR Lentivector set (Human)

K2409901 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human TMPO/ Lamina-associated polypeptide 2, isoforms beta/gamma ELISA Kit

E2522Hu 1 Kit
EUR 571

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

[KO Validated] TMPO Rabbit pAb

A2534-100ul 100 ul
EUR 410

[KO Validated] TMPO Rabbit pAb

A2534-200ul 200 ul
EUR 571

[KO Validated] TMPO Rabbit pAb

A2534-20ul 20 ul
EUR 221

[KO Validated] TMPO Rabbit pAb

A2534-50ul 50 ul
EUR 287

Tmpo ORF Vector (Rat) (pORF)

ORF077980 1.0 ug DNA
EUR 506

Tmpo ORF Vector (Mouse) (pORF)

ORF060007 1.0 ug DNA
EUR 506

Tmpo ORF Vector (Mouse) (pORF)

ORF060008 1.0 ug DNA
EUR 506

Tmpo ORF Vector (Mouse) (pORF)

ORF060009 1.0 ug DNA
EUR 506

Tmpo ORF Vector (Mouse) (pORF)

ORF060010 1.0 ug DNA
EUR 506

Tmpo ORF Vector (Mouse) (pORF)

ORF060011 1.0 ug DNA
EUR 506

Tmpo ORF Vector (Mouse) (pORF)

ORF060012 1.0 ug DNA
EUR 506

pECMV-Tmpo-m-FLAG Plasmid

PVT14942 2 ug
EUR 325

Rat Tmpo/ Lamina-associated polypeptide 2, isoform beta ELISA Kit

E0983Ra 1 Kit
EUR 571

TMPO sgRNA CRISPR Lentivector (Human) (Target 1)

K2409902 1.0 ug DNA
EUR 154

TMPO sgRNA CRISPR Lentivector (Human) (Target 2)

K2409903 1.0 ug DNA
EUR 154

TMPO sgRNA CRISPR Lentivector (Human) (Target 3)

K2409904 1.0 ug DNA
EUR 154

TMPO Protein Vector (Human) (pPB-C-His)

PV043105 500 ng
EUR 329

TMPO Protein Vector (Human) (pPB-N-His)

PV043106 500 ng
EUR 329

TMPO Protein Vector (Human) (pPM-C-HA)

PV043107 500 ng
EUR 329

TMPO Protein Vector (Human) (pPM-C-His)

PV043108 500 ng
EUR 329

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)

KTE70153-48T 48T
EUR 332
  • Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)

KTE70153-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)

KTE70153-96T 96T
EUR 539
  • Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tmpo sgRNA CRISPR Lentivector set (Rat)

K6772801 3 x 1.0 ug
EUR 339

Tmpo sgRNA CRISPR Lentivector set (Mouse)

K4483401 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Tmpo sgRNA CRISPR Lentivector (Rat) (Target 1)

K6772802 1.0 ug DNA
EUR 154

Tmpo sgRNA CRISPR Lentivector (Rat) (Target 2)

K6772803 1.0 ug DNA
EUR 154

Tmpo sgRNA CRISPR Lentivector (Rat) (Target 3)

K6772804 1.0 ug DNA
EUR 154

Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4483402 1.0 ug DNA
EUR 154

Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4483403 1.0 ug DNA
EUR 154

Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4483404 1.0 ug DNA
EUR 154

TMPO Protein Vector (Rat) (pPB-C-His)

PV311918 500 ng
EUR 603

TMPO Protein Vector (Rat) (pPB-N-His)

PV311919 500 ng
EUR 603

TMPO Protein Vector (Rat) (pPM-C-HA)

PV311920 500 ng
EUR 603

TMPO Protein Vector (Rat) (pPM-C-His)

PV311921 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)

PV240026 500 ng
EUR 1065

TMPO Protein Vector (Mouse) (pPB-N-His)

PV240027 500 ng
EUR 1065

TMPO Protein Vector (Mouse) (pPM-C-HA)

PV240028 500 ng
EUR 1065

TMPO Protein Vector (Mouse) (pPM-C-His)

PV240029 500 ng
EUR 1065

TMPO Protein Vector (Mouse) (pPB-C-His)

PV240030 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)

PV240031 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)

PV240032 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)

PV240033 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)

PV240034 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)

PV240035 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)

PV240036 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)

PV240037 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)

PV240038 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)

PV240039 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)

PV240040 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)

PV240041 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)

PV240042 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)

PV240043 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)

PV240044 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)

PV240045 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)

PV240046 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)

PV240047 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)

PV240048 500 ng
EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)

PV240049 500 ng
EUR 603

Tmpo 3'UTR Luciferase Stable Cell Line

TU120829 1.0 ml Ask for price

Tmpo 3'UTR GFP Stable Cell Line

TU170829 1.0 ml Ask for price

Tmpo 3'UTR Luciferase Stable Cell Line

TU222191 1.0 ml Ask for price

TMPO 3'UTR GFP Stable Cell Line

TU075957 1.0 ml
EUR 1394

Tmpo 3'UTR GFP Stable Cell Line

TU272191 1.0 ml Ask for price

TMPO 3'UTR Luciferase Stable Cell Line

TU025957 1.0 ml
EUR 1394

Rat Lamina- associated polypeptide 2, isoform beta, Tmpo ELISA K

ELI-04133r 96 Tests
EUR 886

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2409905 3 x 1.0 ug
EUR 376

TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV671011 1.0 ug DNA
EUR 682

TMPO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV671015 1.0 ug DNA
EUR 682

TMPO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV671016 1.0 ug DNA
EUR 682

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2409906 1.0 ug DNA
EUR 167

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2409907 1.0 ug DNA
EUR 167

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2409908 1.0 ug DNA
EUR 167

Human TMPO(Thymopoietin) ELISA Kit