Human TMPO(Thymopoietin) ELISA Kit
To Order Contact us below: zachary@wildpalm.net
Human Thymopoietin (TMPO) ELISA Kit |
SEC824Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids. |
Human Thymopoietin (TMPO) ELISA Kit |
SEC824Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids. |
Human Thymopoietin (TMPO) ELISA Kit |
SEC824Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids. |
Human Thymopoietin (TMPO) ELISA Kit |
4-SEC824Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thymopoietin elisa. Alternative names of the recognized antigen: TP
- LAP2
- CMD1T
- LEMD4
- TP5
- Splenin
- Lamina-Associated Polypeptide 2, Isoforms Beta/Gamma
- LEM Domain Containing 4
- Thymopoietin-related peptide isoforms beta/gamma
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thymopoietin (TMPO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Thymopoietin ELISA Kit (TMPO) |
RK02407 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Thymopoietin (TMPO) ELISA Kit |
abx516010-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Thymopoietin (TMPO) ELISA Kit |
abx516012-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Thymopoietin(TMPO)ELISA kit |
GA-E0838MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse Thymopoietin(TMPO)ELISA kit |
GA-E0838MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Thymopoietin (TMPO) Antibody |
20-abx116091 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
20-abx131651 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thymopoietin (TMPO) Antibody |
20-abx001974 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
20-abx142268 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
abx030767-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
abx030767-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
abx028266-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
abx028266-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Thymopoietin (TMPO) Antibody |
20-abx174779 |
Abbexa |
|
|
|
Recombinant Thymopoietin (TMPO) |
4-RPC824Hu01 |
Cloud-Clone |
-
EUR 445.86
-
EUR 222.00
-
EUR 1396.96
-
EUR 532.32
-
EUR 964.64
-
EUR 361.00
-
EUR 3342.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P42167
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Thymopoietin expressed in: E.coli |
ELISA kit for Human TMPO (Thymopoietin) |
ELK4922 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thymopoietin (TMPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thymopoietin (
- Show more
|
Description: A sandwich ELISA kit for detection of Thymopoietin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Thymopoietin (TMPO) CLIA Kit |
20-abx493916 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Thymopoietin (TMPO) Protein |
20-abx650199 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1887.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse) |
4-PAC824Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO) |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC |
4-PAC824Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC. |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAC824Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin. |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAC824Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3. |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC |
4-PAC824Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC. |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP |
4-PAC824Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP. |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE |
4-PAC824Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE. |
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAC824Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TMPO (Met1~Leu243)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7. |
Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus) |
APR03096G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications: |
TMPO ELISA Kit (Human) (OKCD02937) |
OKCD02937 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope. Possible receptor for attachment of lamin filaments to the inner nuclear membrane. May be involved in the control of initiation of DNA replication through its interaction with NAKAP95. Thymopoietin (TP) and Thymopentin (TP5) may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL |
TMPO ELISA Kit (Human) (OKEI00289) |
OKEI00289 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: May be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly. Plays an important role, together with LMNA, in the nuclear anchorage of RB1. TP and TP5 may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL |
TMPO / TMPO Antibody |
20-abx329779 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMPO/TMPO Antibody |
1-CSB-PA259190 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000 |
Thymopoietin antibody |
70R-6297 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO |
Thymopoietin antibody |
70R-6298 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Thymopoietin antibody raised against the middle region of TMPO |
Thymopoietin antibody |
70R-6387 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO |
Thymopoietin Antibody |
25390-100ul |
SAB |
100ul |
EUR 390 |
TMPO ELISA Kit (Rat) (OKEH03323) |
OKEH03323 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Binds directly to lamin B1 and chromosomes in a mitotic phosphorylation-regulated manner. May play an important role in nuclear envelope reassembly at the end of mitosis and/or anchoring of the nuclear lamina and interphase chromosomes to the nuclear envelope.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.4 ng/mL |
Polyclonal Thymopoietin Antibody |
APR06736G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Thymopoietin . This antibody is tested and proven to work in the following applications: |
Thymopoietin Blocking Peptide |
33R-6275 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6297 |
Thymopoietin Blocking Peptide |
33R-2506 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6298 |
Thymopoietin Blocking Peptide |
33R-7041 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6387 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TMPO siRNA |
20-abx900018 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMPO siRNA |
20-abx900039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMPO siRNA |
20-abx937501 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMPO siRNA |
20-abx937502 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMPO siRNA |
20-abx937503 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMPO antibody |
70R-20884 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TMPO antibody |
TMPO Antibody |
32699-100ul |
SAB |
100ul |
EUR 252 |
TMPO Antibody |
DF6994 |
Affbiotech |
200ul |
EUR 304 |
Description: TMPO Antibody detects endogenous levels of total TMPO. |
TMPO Antibody |
1-CSB-PA023913GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
anti-TMPO |
YF-PA27383 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TMPO |
Human TMPO shRNA Plasmid |
20-abx954879 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TMPO shRNA Plasmid |
20-abx954880 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TMPO Recombinant Protein (Human) |
RP032329 |
ABM |
100 ug |
Ask for price |
TMPO Conjugated Antibody |
C32699 |
SAB |
100ul |
EUR 397 |
TMPO cloning plasmid |
CSB-CL023913HU-10ug |
Cusabio |
10ug |
EUR 492 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1365
- Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca
- Show more
|
Description: A cloning plasmid for the TMPO gene. |
TMPO Polyclonal Antibody |
ES8548-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
TMPO Polyclonal Antibody |
ES8548-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
TMPO Polyclonal Antibody |
ABP57555-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic peptide from human protein at AA range: 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50 |
TMPO Polyclonal Antibody |
ABP57555-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic peptide from human protein at AA range: 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50 |
TMPO Polyclonal Antibody |
ABP57555-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic peptide from human protein at AA range: 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50 |
TMPO Polyclonal Antibody |
46756-100ul |
SAB |
100ul |
EUR 252 |
TMPO Polyclonal Antibody |
46756-50ul |
SAB |
50ul |
EUR 187 |
TMPO Blocking Peptide |
DF6994-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-TMPO antibody |
STJ98661 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein. |
Anti-TMPO antibody |
STJ25881 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. |
TMPO ORF Vector (Human) (pORF) |
ORF010777 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat TMPO shRNA Plasmid |
20-abx984957 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-TMPO/Lap2 Antibody |
A03278 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat. |
Mouse TMPO shRNA Plasmid |
20-abx973144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TMPO shRNA Plasmid |
20-abx973145 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TMPO Recombinant Protein (Rat) |
RP233936 |
ABM |
100 ug |
Ask for price |
TMPO Recombinant Protein (Mouse) |
RP180017 |
ABM |
100 ug |
Ask for price |
TMPO Recombinant Protein (Mouse) |
RP180020 |
ABM |
100 ug |
Ask for price |
TMPO Recombinant Protein (Mouse) |
RP180023 |
ABM |
100 ug |
Ask for price |
TMPO Recombinant Protein (Mouse) |
RP180026 |
ABM |
100 ug |
Ask for price |
TMPO Recombinant Protein (Mouse) |
RP180029 |
ABM |
100 ug |
Ask for price |
TMPO Recombinant Protein (Mouse) |
RP180032 |
ABM |
100 ug |
Ask for price |
TMPO sgRNA CRISPR Lentivector set (Human) |
K2409901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human TMPO/ Lamina-associated polypeptide 2, isoforms beta/gamma ELISA Kit |
E2522Hu |
Sunlong |
1 Kit |
EUR 571 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
[KO Validated] TMPO Rabbit pAb |
A2534-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] TMPO Rabbit pAb |
A2534-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] TMPO Rabbit pAb |
A2534-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] TMPO Rabbit pAb |
A2534-50ul |
Abclonal |
50 ul |
EUR 287 |
Tmpo ORF Vector (Mouse) (pORF) |
ORF060007 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmpo ORF Vector (Mouse) (pORF) |
ORF060008 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmpo ORF Vector (Mouse) (pORF) |
ORF060009 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmpo ORF Vector (Mouse) (pORF) |
ORF060010 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmpo ORF Vector (Mouse) (pORF) |
ORF060011 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmpo ORF Vector (Mouse) (pORF) |
ORF060012 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmpo ORF Vector (Rat) (pORF) |
ORF077980 |
ABM |
1.0 ug DNA |
EUR 506 |
TMPO sgRNA CRISPR Lentivector (Human) (Target 1) |
K2409902 |
ABM |
1.0 ug DNA |
EUR 154 |
TMPO sgRNA CRISPR Lentivector (Human) (Target 2) |
K2409903 |
ABM |
1.0 ug DNA |
EUR 154 |
TMPO sgRNA CRISPR Lentivector (Human) (Target 3) |
K2409904 |
ABM |
1.0 ug DNA |
EUR 154 |
TMPO Protein Vector (Human) (pPB-C-His) |
PV043105 |
ABM |
500 ng |
EUR 329 |
TMPO Protein Vector (Human) (pPB-N-His) |
PV043106 |
ABM |
500 ng |
EUR 329 |
TMPO Protein Vector (Human) (pPM-C-HA) |
PV043107 |
ABM |
500 ng |
EUR 329 |
TMPO Protein Vector (Human) (pPM-C-His) |
PV043108 |
ABM |
500 ng |
EUR 329 |
Rat Tmpo/ Lamina-associated polypeptide 2, isoform beta ELISA Kit |
E0983Ra |
Sunlong |
1 Kit |
EUR 571 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) |
KTE70153-48T |
Abbkine |
48T |
EUR 332 |
- Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) |
KTE70153-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) |
KTE70153-96T |
Abbkine |
96T |
EUR 539 |
- Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Tmpo sgRNA CRISPR Lentivector set (Mouse) |
K4483401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tmpo sgRNA CRISPR Lentivector set (Rat) |
K6772801 |
ABM |
3 x 1.0 ug |
EUR 339 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4483402 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4483403 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4483404 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmpo sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6772802 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmpo sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6772803 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmpo sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6772804 |
ABM |
1.0 ug DNA |
EUR 154 |
TMPO Protein Vector (Rat) (pPB-C-His) |
PV311918 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Rat) (pPB-N-His) |
PV311919 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Rat) (pPM-C-HA) |
PV311920 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Rat) (pPM-C-His) |
PV311921 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-C-His) |
PV240026 |
ABM |
500 ng |
EUR 1065 |
TMPO Protein Vector (Mouse) (pPB-N-His) |
PV240027 |
ABM |
500 ng |
EUR 1065 |
TMPO Protein Vector (Mouse) (pPM-C-HA) |
PV240028 |
ABM |
500 ng |
EUR 1065 |
TMPO Protein Vector (Mouse) (pPM-C-His) |
PV240029 |
ABM |
500 ng |
EUR 1065 |
TMPO Protein Vector (Mouse) (pPB-C-His) |
PV240030 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-N-His) |
PV240031 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-HA) |
PV240032 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-His) |
PV240033 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-C-His) |
PV240034 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-N-His) |
PV240035 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-HA) |
PV240036 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-His) |
PV240037 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-C-His) |
PV240038 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-N-His) |
PV240039 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-HA) |
PV240040 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-His) |
PV240041 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-C-His) |
PV240042 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-N-His) |
PV240043 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-HA) |
PV240044 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-His) |
PV240045 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-C-His) |
PV240046 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPB-N-His) |
PV240047 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-HA) |
PV240048 |
ABM |
500 ng |
EUR 603 |
TMPO Protein Vector (Mouse) (pPM-C-His) |
PV240049 |
ABM |
500 ng |
EUR 603 |
Tmpo 3'UTR GFP Stable Cell Line |
TU170829 |
ABM |
1.0 ml |
Ask for price |
TMPO 3'UTR GFP Stable Cell Line |
TU075957 |
ABM |
1.0 ml |
EUR 1394 |
Tmpo 3'UTR Luciferase Stable Cell Line |
TU120829 |
ABM |
1.0 ml |
Ask for price |
TMPO 3'UTR Luciferase Stable Cell Line |
TU025957 |
ABM |
1.0 ml |
EUR 1394 |
Tmpo 3'UTR Luciferase Stable Cell Line |
TU222191 |
ABM |
1.0 ml |
Ask for price |
Tmpo 3'UTR GFP Stable Cell Line |
TU272191 |
ABM |
1.0 ml |
Ask for price |
Rat Lamina- associated polypeptide 2, isoform beta, Tmpo ELISA K |
ELI-04133r |
Lifescience Market |
96 Tests |
EUR 886 |
TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K2409905 |
ABM |
3 x 1.0 ug |
EUR 376 |
TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV671011 |
ABM |
1.0 ug DNA |
EUR 682 |
TMPO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV671015 |
ABM |
1.0 ug DNA |
EUR 682 |
TMPO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV671016 |
ABM |
1.0 ug DNA |
EUR 682 |
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K2409906 |
ABM |
1.0 ug DNA |
EUR 167 |
TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K2409907 |
ABM |
1.0 ug DNA |
EUR 167 |
TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K2409908 |
ABM |
1.0 ug DNA |
EUR 167 |
Human TMPO(Thymopoietin) ELISA Kit