Human SGCd(Sarcoglycan Delta) ELISA Kit

Human SGCd(Sarcoglycan Delta) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Sarcoglycan Delta (SGCd) ELISA Kit
RDR-SGCd-Hu-48Tests 48 Tests
EUR 544

Human Sarcoglycan Delta (SGCd) ELISA Kit
RDR-SGCd-Hu-96Tests 96 Tests
EUR 756

Human Sarcoglycan delta (SGCd) ELISA Kit
20-abx153016
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Delta- sarcoglycan, SGCD ELISA KIT
ELI-36009h 96 Tests
EUR 824

Human Sarcoglycan Delta(SGCd)ELISA Kit
QY-E03015 96T
EUR 400

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
4-SEE226Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcoglycan Delta elisa. Alternative names of the recognized antigen: 35DAG
  • CMD1L
  • DAGD
  • SG-delta
  • SGCDP
  • SGD
  • 35kDa Dystrophin-Associated Glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcoglycan Delta (SGCd) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sarcoglycan Delta (SGCD) Antibody
20-abx005293
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sarcoglycan Delta (SGCd) Antibody
20-abx130531
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sarcoglycan Delta (SGCd) Antibody
20-abx174456
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcoglycan Delta (SGCD) Protein
20-abx261024
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Sarcoglycan Delta (SGCD) Antibody
20-abx322415
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Sarcoglycan Delta (SGCd)
4-RPE226Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92629
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Sarcoglycan Delta expressed in: E.coli

Human Sarcoglycan Delta (SGCd) Protein
20-abx650584
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Delta- sarcoglycan, Sgcd ELISA KIT
ELI-18647m 96 Tests
EUR 865

Human Sarcoglycan delta (SGCd) CLIA Kit
20-abx494548
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SGCd (Sarcoglycan Delta)
ELK4751 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcoglycan Delta (SGC?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcoglyc
  • Show more
Description: A sandwich ELISA kit for detection of Sarcoglycan Delta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Delta-sarcoglycan (SGCD)
KTE60672-48T 48T
EUR 332
  • Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Delta-sarcoglycan (SGCD)
KTE60672-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Delta-sarcoglycan (SGCD)
KTE60672-96T 96T
EUR 539
  • Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human)
4-PAE226Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd)

SGCD Sarcoglycan Delta Human Recombinant Protein
PROTQ92629 Regular: 20ug
EUR 317
Description: SGCD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 257 amino acids (57-289a.a) and having a molecular mass of 28kDa. SGCD is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Polyclonal SGCD / Delta-Sarcoglycan Antibody (Internal)
APG01191G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SGCD / Delta-Sarcoglycan (Internal). This antibody is tested and proven to work in the following applications:

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC
4-PAE226Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Biotinylated
4-PAE226Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Biotin.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Cy3
4-PAE226Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Cy3.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), FITC
4-PAE226Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with FITC.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), HRP
4-PAE226Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with HRP.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), PE
4-PAE226Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with PE.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC-Cy7
4-PAE226Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC-Cy7.

delta Sarcoglycan Antibody
49501-100ul 100ul
EUR 333

delta Sarcoglycan Antibody
49501-50ul 50ul
EUR 239

Sarcoglycan delta Antibody
20-abx137486
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

delta-Sarcoglycan Antibody
20-abx142221
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Delta-Sarcoglycan Antibody
abx431803-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

anti-delta Sarcoglycan
YF-PA14616 50 ug
EUR 363
Description: Mouse polyclonal to delta Sarcoglycan

anti-delta Sarcoglycan
YF-PA14617 100 ul
EUR 403
Description: Rabbit polyclonal to delta Sarcoglycan

anti-delta Sarcoglycan
YF-PA14618 100 ug
EUR 403
Description: Rabbit polyclonal to delta Sarcoglycan

delta Sarcoglycan Conjugated Antibody
C49501 100ul
EUR 397

Delta-Sarcoglycan Antibody (Biotin)
abx431804-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-delta Sarcoglycan Rabbit Monoclonal Antibody
M05297 100ug/vial
EUR 397
Description: Rabbit Monoclonal delta Sarcoglycan Antibody. Validated in IP, WB and tested in Human.

Anti-Delta-Sarcoglycan (aa245-257) antibody
STJ72512 100 µg
EUR 359

SGCD ELISA Kit (Human) (OKCD01259)
OKCD01259 96 Wells
EUR 831
Description: Description of target: Component of the sarcoglycan complex, a subcomplex of the dystrophin-glycoprotein complex which forms a link between the F-actin cytoskeleton and the extracellular matrix. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.28 ng/mL

Anti-Delta-Sarcoglycan (aa245-257), Biotinylated antibody
STJ73241 100 µg
EUR 359

Alpha-sarcoglycan ELISA KIT|Human
EF007731 96 Tests
EUR 689

Beta sarcoglycan ELISA KIT|Human
EF008107 96 Tests
EUR 689

Polyclonal Delta-Sarcoglycan (aa245-257) Antibody (internal region)
APR15718G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Delta-Sarcoglycan (aa245-257) (internal region). This antibody is tested and proven to work in the following applications:

Sarcoglycan-
ABD8605 100 ug
EUR 438

Human Beta-Sarcoglycan (SGCB) ELISA Kit
20-abx259434
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Gamma- sarcoglycan, SGCG ELISA KIT
ELI-15568h 96 Tests
EUR 824

Human Zeta- sarcoglycan, SGCZ ELISA KIT
ELI-52469h 96 Tests
EUR 824

Human Sarcoglycan Alpha (SGCA) ELISA Kit
20-abx385720
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Sarcoglycan Epsilon (SGCE) ELISA Kit
abx383152-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Sarcoglycan Gamma (SGCG) ELISA Kit
abx383153-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Beta- sarcoglycan, SGCB ELISA KIT
ELI-39348h 96 Tests
EUR 824

Human Alpha- sarcoglycan, SGCA ELISA KIT
ELI-40829h 96 Tests
EUR 824

Human Epsilon- sarcoglycan, SGCE ELISA KIT
ELI-40830h 96 Tests
EUR 824

Human β sarcoglycan(SGCB) ELISA kit
E01B0966-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β sarcoglycan(SGCB) ELISA kit
E01B0966-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β sarcoglycan(SGCB) ELISA kit
E01B0966-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha sarcoglycan(SGCA) ELISA kit
E01A1973-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha sarcoglycan(SGCA) ELISA kit
E01A1973-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha sarcoglycan(SGCA) ELISA kit
E01A1973-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sarcoglycan Zeta(SGCz)ELISA Kit
QY-E03013 96T
EUR 400

Human Sarcoglycan Epsilon(SGCe)ELISA Kit
QY-E03014 96T
EUR 400

Human Sarcoglycan Gamma(SGCg)ELISA Kit
QY-E03016 96T
EUR 400

Human Sarcoglycan Beta(SGCb)ELISA Kit
QY-E03017 96T
EUR 400

SGCD Antibody
47201-100ul 100ul
EUR 252

SGCD antibody
10R-10249 50 ul
EUR 219
Description: Mouse monoclonal SGCD antibody

SGCD Antibody
1-CSB-PA835688ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGCD. Recognizes SGCD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SGCD siRNA
20-abx933150
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SGCD siRNA
20-abx933151
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Beta Sarcoglycan (beta sarcoglycan) Antibody
20-abx008721
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Sarcoglycan (Beta sarcoglycan) Antibody
abx230878-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human SGCD shRNA Plasmid
20-abx954355
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SGCD Recombinant Protein (Human)
RP028375 100 ug Ask for price

SGCD Rabbit pAb
A13351-100ul 100 ul
EUR 308

SGCD Rabbit pAb
A13351-200ul 200 ul
EUR 459

SGCD Rabbit pAb
A13351-20ul 20 ul
EUR 183

SGCD Rabbit pAb
A13351-50ul 50 ul
EUR 223

SGCD Conjugated Antibody
C47201 100ul
EUR 397

SGCD cloning plasmid
CSB-CL835688HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgatgcctcaggagcagtacactcaccaccggagcaccatgcctggctctgtggggccacaggtatacaaggtggggatttacggctggcggaaacgatgcctgtatttctttgtcctgctcctcatgattttaatactggtgaacttggccatgaccatctggattctcaaagt
  • Show more
Description: A cloning plasmid for the SGCD gene.

SGCD Rabbit pAb
A6980-100ul 100 ul
EUR 308

SGCD Rabbit pAb
A6980-200ul 200 ul
EUR 459

SGCD Rabbit pAb
A6980-20ul 20 ul
EUR 183

SGCD Rabbit pAb
A6980-50ul 50 ul
EUR 223

SGCD Polyclonal Antibody
ABP60383-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein

SGCD Polyclonal Antibody
ABP60383-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein

SGCD Polyclonal Antibody
ABP60383-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein

SGCD Polyclonal Antibody
ES11141-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SGCD Polyclonal Antibody
ES11141-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SGCD antibody
STJ29060 100 µl
EUR 277
Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.

Human SGCd(Sarcoglycan Delta) ELISA Kit