Human CRBN(Cereblon) ELISA Kit
To Order Contact us below: zachary@wildpalm.net
Human Cereblon (CRBN) ELISA Kit |
RD-CRBN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cereblon (CRBN) ELISA Kit |
RD-CRBN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Cereblon (CRBN) ELISA Kit |
DLR-CRBN-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
DLR-CRBN-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
RDR-CRBN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Cereblon (CRBN) ELISA Kit |
RDR-CRBN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Cereblon (CRBN) ELISA Kit |
RD-CRBN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Cereblon (CRBN) ELISA Kit |
RD-CRBN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Cereblon (CRBN) ELISA Kit |
20-abx151037 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Cereblon (CRBN)ELISA Kit |
201-12-2889 |
SunredBio |
96 tests |
EUR 440 |
- This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Cereblon ELISA Kit (CRBN) |
RK01182 |
Abclonal |
96 Tests |
EUR 521 |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
4-SEG676Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
- Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Cereblon (CRBN) ELISA Kit |
20-abx153810 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
4-SEG676Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
- Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Cereblon (CRBN) Antibody |
20-abx111556 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cereblon (CRBN) Antibody |
20-abx175781 |
Abbexa |
|
|
|
Cereblon (CRBN) Antibody |
20-abx175782 |
Abbexa |
|
|
|
Cereblon (CRBN) Antibody |
20-abx175783 |
Abbexa |
|
|
|
Cereblon (CRBN) Antibody |
20-abx171671 |
Abbexa |
|
|
|
Human CRBN/ Protein cereblon ELISA Kit |
E0552Hu |
Sunlong |
1 Kit |
EUR 605 |
Human CRBN(Protein cereblon) ELISA Kit |
EH1457 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q96SW2
- Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
ELISA kit for Human CRBN (Cereblon) |
ELK4870 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Protein cereblon (CRBN) ELISA Kit |
abx250736-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Cereblon (CRBN) CLIA Kit |
20-abx495269 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Cereblon (CRBN) Protein |
20-abx652846 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Protein cereblon (CRBN) |
1-CSB-BP842761HU |
Cusabio |
-
EUR 761.00
-
EUR 306.00
-
EUR 1951.00
-
EUR 1026.00
-
EUR 1422.00
-
EUR 431.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus |
Human Protein cereblon (CRBN) |
1-CSB-CF842761HU |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 54.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system |
Human Protein cereblon (CRBN) |
1-CSB-CF842761HUa6 |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 64.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system |
Human Protein cereblon (CRBN) |
1-CSB-CF842761HUc7 |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 51.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system |
Cow Protein cereblon (CRBN) ELISA Kit |
abx516195-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Protein cereblon (CRBN) ELISA Kit |
abx516196-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Protein cereblon (CRBN) ELISA Kit |
abx516199-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse CRBN (Cereblon) |
ELK7246 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Cereblon (CRBN) CLIA Kit |
20-abx495270 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Cereblon (CRBN) Protein |
20-abx652847 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Cereblon (CRBN) Protein |
20-abx652848 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Protein Cereblon (CRBN) Antibody |
20-abx003568 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Cereblon (CRBN) Antibody |
20-abx322665 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Cereblon (CRBN) Antibody |
20-abx322666 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Cereblon (CRBN) Antibody |
abx200563-50ug |
Abbexa |
50 ug |
EUR 453 |
- Shipped within 3-5 working days.
|
Protein Cereblon (CRBN) Antibody |
abx231954-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Mouse Protein cereblon (Crbn) |
1-CSB-YP806030MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 54.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast |
Crbn ELISA Kit| Rat Protein cereblon ELISA Kit |
EF018463 |
Lifescience Market |
96 Tests |
EUR 689 |
CRBN ELISA Kit| chicken Protein cereblon ELISA Kit |
EF012243 |
Lifescience Market |
96 Tests |
EUR 689 |
Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit |
EF014465 |
Lifescience Market |
96 Tests |
EUR 689 |
CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit |
EF011221 |
Lifescience Market |
96 Tests |
EUR 689 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Polyclonal CRBN / Cereblon Antibody (C-Terminus) |
APR11660G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications: |
CRBN ELISA Kit (Human) (OKAN05721) |
OKAN05721 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
CRBN ELISA Kit (Human) (OKCD08967) |
OKCD08967 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutatio;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
CRBN ELISA Kit (Human) (OKEH02269) |
OKEH02269 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2 ng/mL |
ELISA kit for Human Protein cereblon |
EK3125 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids. |
CRBN ELISA Kit (Mouse) (OKCD02462) |
OKCD02462 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2. Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8. May play a role in memory and learning by regulating the assembly and neuronal surface expression of large-conductance calcium-activated potassium channels in brain regions involved in memory and learning via its interaction with KCNT1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
CRBN ELISA Kit (Bovine) (OKEH07882) |
OKEH07882 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
CRBN ELISA Kit (Chicken) (OKEH07883) |
OKEH07883 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
CRBN siRNA |
20-abx901245 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRBN siRNA |
20-abx912756 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRBN siRNA |
20-abx912757 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRBN antibody |
70R-3211 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN |
CRBN antibody |
70R-16578 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CRBN antibody |
CRBN Antibody |
DF12054 |
Affbiotech |
200ul |
EUR 304 |
Description: CRBN antibody detects endogenous levels of CRBN. |
CRBN Antibody |
1-CSB-PA005944GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CRBN Antibody |
1-CSB-PA842761ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CRBN Antibody |
1-CSB-PA842761ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
anti-CRBN |
YF-PA18916 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CRBN |
Human CRBN shRNA Plasmid |
20-abx959590 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal CRBN Antibody |
APR11661G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications: |
anti- CRBN antibody |
FNab01954 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:200
- Immunogen: cereblon
- Uniprot ID: Q96SW2
- Gene ID: 51185
- Research Area: Metabolism
|
Description: Antibody raised against CRBN |
CRBN Rabbit pAb |
A4722-100ul |
Abclonal |
100 ul |
EUR 308 |
CRBN Rabbit pAb |
A4722-200ul |
Abclonal |
200 ul |
EUR 459 |
CRBN Rabbit pAb |
A4722-20ul |
Abclonal |
20 ul |
EUR 183 |
CRBN Rabbit pAb |
A4722-50ul |
Abclonal |
50 ul |
EUR 223 |
CRBN Blocking Peptide |
33R-2125 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211 |
CRBN Polyclonal Antibody |
30601-100ul |
SAB |
100ul |
EUR 252 |
CRBN Polyclonal Antibody |
30601-50ul |
SAB |
50ul |
EUR 187 |
CRBN Blocking Peptide |
DF12054-BP |
Affbiotech |
1mg |
EUR 195 |
CRBN cloning plasmid |
CSB-CL842761HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1329
- Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat
- Show more
|
Description: A cloning plasmid for the CRBN gene. |
CRBN cloning plasmid |
CSB-CL842761HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1326
- Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
- Show more
|
Description: A cloning plasmid for the CRBN gene. |
Human CRBN(Cereblon) ELISA Kit