Human PES1(Pescadillo Homolog 1) ELISA Kit

Human PES1(Pescadillo Homolog 1) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Pescadillo Homolog 1 (PES1) ELISA Kit

SEK173Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pescadillo Homolog 1 (PES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pescadillo Homolog 1 (PES1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pescadillo Homolog 1 (PES1) ELISA Kit

4-SEK173Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Pescadillo Homolog 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pescadillo Homolog 1 (PES1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Pescadillo homolog, PES1 ELISA KIT

ELI-44895h 96 Tests
EUR 824

Pescadillo Homolog 1 (PES1) Antibody

20-abx128179
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pescadillo Homolog 1 (PES1) Antibody

20-abx174013
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Pescadillo Homolog 1 (PES1)

4-RPK173Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00541
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Pescadillo Homolog 1 expressed in: E.coli

Human Pescadillo Homolog 1 (PES1) Protein

20-abx167019
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Pescadillo homolog, Pes1 ELISA KIT

ELI-43689m 96 Tests
EUR 865

Human Pescadillo Homolog 1 (PES1) CLIA Kit

20-abx495831
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PES1 (Pescadillo Homolog 1)

ELK5001 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pescadillo Homolog 1 (PES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pescad
  • Show more
Description: A sandwich ELISA kit for detection of Pescadillo Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Pescadillo homolog (PES1)

KTE61247-48T 48T
EUR 332
  • PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pescadillo homolog (PES1)

KTE61247-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pescadillo homolog (PES1)

KTE61247-96T 96T
EUR 539
  • PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human)

4-PAK173Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1)

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), APC

4-PAK173Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with APC.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), Biotinylated

4-PAK173Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with Biotin.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), Cy3

4-PAK173Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with Cy3.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), FITC

4-PAK173Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with FITC.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), HRP

4-PAK173Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with HRP.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), PE

4-PAK173Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with PE.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), APC-Cy7

4-PAK173Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PES1 (Met1~Ser415)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with APC-Cy7.

Pescadillo Ribosomal Biogenesis Factor 1 (Pes1) Antibody

20-abx114415
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody

abx030785-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody

abx030785-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody

20-abx318092
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody

abx236324-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (HRP)

20-abx317086
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (FITC)

20-abx317087
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (Biotin)

20-abx317088
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Pes1/ Rat Pes1 ELISA Kit

ELI-45915r 96 Tests
EUR 886

PES1 ELISA KIT|Human

EF001685 96 Tests
EUR 689

Pescadillo Antibody

abx432062-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

anti-Pescadillo

YF-PA17912 50 ug
EUR 363
Description: Mouse polyclonal to Pescadillo

anti-Pescadillo

YF-PA17913 50 ul
EUR 363
Description: Mouse polyclonal to Pescadillo

anti-Pescadillo

YF-PA17914 50 ug
EUR 363
Description: Mouse polyclonal to Pescadillo

Anti-Pescadillo antibody

STJ70378 100 µg
EUR 359

PES1 siRNA

20-abx903944
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PES1 siRNA

20-abx928258
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PES1 siRNA

20-abx928259
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PES1 antibody

70R-3107 50 ug
EUR 467
Description: Rabbit polyclonal PES1 antibody

PES1 antibody

70R-19216 50 ul
EUR 435
Description: Rabbit polyclonal PES1 antibody

PES1 Antibody

1-CSB-PA017791GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PES1 Antibody

1-CSB-PA017791LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Human PES1 shRNA Plasmid

20-abx958299
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PES1 Recombinant Protein (Human)

RP023110 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PES1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1628302 1.0 ug DNA
EUR 154

PES1 cloning plasmid

CSB-CL017791HU-10ug 10ug
EUR 604
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1767
  • Sequence: atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttcta
  • Show more
Description: A cloning plasmid for the PES1 gene.

anti- PES1 antibody

FNab06324 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: pescadillo homolog 1, containing BRCT domain(zebrafish)
  • Uniprot ID: O00541
  • Research Area: Metabolism
Description: Antibody raised against PES1

PES1 Rabbit pAb

A14506-100ul 100 ul
EUR 308

PES1 Rabbit pAb

A14506-200ul 200 ul
EUR 459

PES1 Rabbit pAb

A14506-20ul 20 ul
EUR 183

PES1 Rabbit pAb

A14506-50ul 50 ul
EUR 223

PES1 Blocking Peptide

33R-4489 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PES1 antibody, catalog no. 70R-3107

PES1 Polyclonal Antibody

28606-100ul 100ul
EUR 252

PES1 Polyclonal Antibody

28606-50ul 50ul
EUR 187

Anti-PES1 antibody

PAab06324 100 ug
EUR 386

Anti-PES1 antibody

STJ116717 100 µl
EUR 277
Description: This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9.

PES1 ORF Vector (Human) (pORF)

ORF007704 1.0 ug DNA
EUR 95

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human Notch Homolog 1 ELISA kit

E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Polyclonal Goat Anti-Pescadillo Antibody

APG00241G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Pescadillo . This antibody is tested and proven to work in the following applications:

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

PES1 Polyclonal Conjugated Antibody

C28606 100ul
EUR 397

Mouse PES1 shRNA Plasmid

20-abx975318
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PES1 shRNA Plasmid

20-abx988405
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PES1 Antibody, HRP conjugated

1-CSB-PA017791LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PES1 Antibody, FITC conjugated

1-CSB-PA017791LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PES1 Antibody, Biotin conjugated

1-CSB-PA017791LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PES1 Recombinant Protein (Rat)

RP220061 100 ug Ask for price

pCMV-SPORT6-Pes1-m

PVT18832 2 ug
EUR 231

PES1 Recombinant Protein (Mouse)

RP161348 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Pes1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4779202 1.0 ug DNA
EUR 154

Pes1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7130902 1.0 ug DNA
EUR 154

PES1 sgRNA CRISPR Lentivector set (Human)

K1628301 3 x 1.0 ug
EUR 339

Human Dachshund Homolog 1 (DACH1) ELISA Kit

abx556324-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human PES1(Pescadillo Homolog 1) ELISA Kit