Human THBS3(Thrombospondin 3) ELISA Kit
To Order Contact us below: zachary@wildpalm.net
Human Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
DLR-THBS3-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
DLR-THBS3-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RDR-THBS3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RDR-THBS3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Thrombospondin 3 (THBS3) ELISA Kit |
20-abx156876 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Thrombospondin 3 (THBS3) ELISA Kit |
abx259888-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
4-SED823Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
20-abx154756 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
4-SED823Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human THBS3 (Thrombospondin 3) |
ELK5166 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Thrombospondin 3 (THBS3) CLIA Kit |
20-abx494398 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Thrombospondin-3 (Thbs3) |
1-CSB-EP023489MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 62.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli |
Mouse Thrombospondin-3 (Thbs3) |
1-CSB-YP023489MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 37.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast |
Thrombospondin 3 (THBS3) Antibody |
20-abx178573 |
Abbexa |
|
|
|
Thrombospondin 3 (THBS3) Antibody |
20-abx178574 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx110655 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx110656 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx116967 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx123257 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx128997 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx030681-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx030681-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx238675-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx320416 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx431668-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Recombinant Thrombospondin 3 (THBS3) |
4-RPD823Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P49746
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 58.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli |
Human Thrombospondin 3 (THBS3) Protein |
20-abx166577 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse THBS3 (Thrombospondin 3) |
ELK6457 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Thrombospondin 3 (THBS3) CLIA Kit |
20-abx494399 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Thrombospondin 3 (THBS3) Antibody (Biotin) |
20-abx106391 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (Biotin) |
20-abx106392 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (FITC) |
20-abx107803 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (FITC) |
20-abx107804 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (HRP) |
20-abx109221 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (HRP) |
20-abx109222 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Thrombospondin 3 (THBS3) Protein |
20-abx655225 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Thrombospondin 3 (THBS3) Protein |
20-abx655226 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human) |
4-PAD823Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3) |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC |
4-PAD823Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated |
4-PAD823Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3 |
4-PAD823Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC |
4-PAD823Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP |
4-PAD823Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE |
4-PAD823Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD823Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7. |
Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus) |
AMM08184G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
THBS3 ELISA Kit (Human) (OKCD00691) |
OKCD00691 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL |
Thbs3 ELISA Kit (Mouse) (OKCD01781) |
OKCD01781 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 25.3 pg/mL |
Human Thrombospondin 3 (TSP-3)ELISA Kit |
201-12-2387 |
SunredBio |
96 tests |
EUR 440 |
- This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
THBS3 antibody |
70R-21720 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal THBS3 antibody |
Thbs3 Antibody |
1-CSB-PA023489DA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
Thbs3 Antibody |
1-CSB-PA023489EA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
THBS3 Antibody |
1-CSB-PA023489ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
THBS3 Antibody |
1-CSB-PA023489GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
THBS3 siRNA |
20-abx936680 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THBS3 siRNA |
20-abx936681 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human THBS3 shRNA Plasmid |
20-abx954831 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
THBS3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2368904 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Thrombospondin 1 ELISA kit |
E01T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 1 ELISA kit |
E01T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 1 ELISA kit |
E01T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin-2 ELISA kit |
LF-EK50605 |
Abfrontier |
1×96T |
EUR 648 |
THBS3 cloning plasmid |
CSB-CL023489HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1458
- Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT
- Show more
|
Description: A cloning plasmid for the THBS3 gene. |
Thbs3 Polyclonal Antibody |
A57726 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Thbs3 Polyclonal Antibody |
A57777 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
THBS3 Rabbit pAb |
A3641-100ul |
Abclonal |
100 ul |
EUR 308 |
THBS3 Rabbit pAb |
A3641-200ul |
Abclonal |
200 ul |
EUR 459 |
THBS3 Rabbit pAb |
A3641-20ul |
Abclonal |
20 ul |
EUR 183 |
THBS3 Rabbit pAb |
A3641-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-THBS3 antibody |
STJ25845 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
THBS3 ORF Vector (Human) (pORF) |
ORF014707 |
ABM |
1.0 ug DNA |
EUR 354 |
Human Thrombospondin 1 (THBS1) ELISA Kit |
DLR-THBS1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma. |
Human Thrombospondin 1 (THBS1) ELISA Kit |
DLR-THBS1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma. |
Human Thrombospondin 2 (THBS2) ELISA Kit |
DLR-THBS2-Hu-48T |
DL Develop |
48T |
EUR 387 |
- Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids. |
Human Thrombospondin 2 (THBS2) ELISA Kit |
DLR-THBS2-Hu-96T |
DL Develop |
96T |
EUR 494 |
- Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
DLR-THBS4-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
DLR-THBS4-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids. |
Human Thrombospondin-2(THBS2) ELISA kit |
CSB-EL023488HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Thrombospondin-2(THBS2) ELISA kit |
1-CSB-EL023488HU |
Cusabio |
-
EUR 602.00
-
EUR 4238.00
-
EUR 2256.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Thrombospondin-4(THBS4) ELISA kit |
CSB-EL023490HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4 (THBS4) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Thrombospondin-4(THBS4) ELISA kit |
1-CSB-EL023490HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4(THBS4) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Thrombospondin 1(THBS1) ELISA kit |
E01T0686-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 1(THBS1) ELISA kit |
E01T0686-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 1(THBS1) ELISA kit |
E01T0686-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 2(THBS2) ELISA kit |
E01T0687-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 2(THBS2) ELISA kit |
E01T0687-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 2(THBS2) ELISA kit |
E01T0687-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin-2 (JAK2) ELISA Kit |
abx050226-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-10 working days.
|
Human Thrombospondin 1 (THBS1) ELISA Kit |
abx052577-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-10 working days.
|
Human Thrombospondin 1 (THBS1) ELISA Kit |
20-abx153283 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Thrombospondin 2 (THBS2) ELISA Kit |
20-abx153284 |
Abbexa |
-
EUR 5311.00
-
EUR 2837.00
-
EUR 668.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Thrombospondin 4 (THBS4) ELISA Kit |
20-abx153285 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Thrombospondin 4 (THBS4) ELISA Kit |
abx253753-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 2 (THBS2) ELISA Kit |
abx250162-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 1 (THBS1) ELISA Kit |
abx253325-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 4 (THBS4) ELISA Kit |
abx253326-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human THBS1/ Thrombospondin-1 ELISA Kit |
E2490Hu |
Sunlong |
1 Kit |
EUR 537 |
Human THBS2/ Thrombospondin-2 ELISA Kit |
E2491Hu |
Sunlong |
1 Kit |
EUR 537 |
Human THBS4/ Thrombospondin-4 ELISA Kit |
E2492Hu |
Sunlong |
1 Kit |
EUR 571 |
Human THBS4(Thrombospondin-4) ELISA Kit |
EH0795 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P35443
- Alias: TSP-4(Thrombospondin-4)/THBS4
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Thrombospondin 4 (THBS4) ELISA Kit |
abx571192-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 1 (THBS1) ELISA Kit |
abx571959-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 2 (THBS2) ELISA Kit |
abx576059-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Thrombospondin-2 ELISA kit (4X96T) |
LF-EK50606 |
Abfrontier |
4×96T |
EUR 2201 |
Human Thrombospondin 1 (THBS1) ELISA Kit |
RDR-THBS1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Thrombospondin 1 (THBS1) ELISA Kit |
RDR-THBS1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Thrombospondin 2 (THBS2) ELISA Kit |
RDR-THBS2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 390 |
Human Thrombospondin 2 (THBS2) ELISA Kit |
RDR-THBS2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 536 |
Human Thrombospondin 4 (THBS4) ELISA Kit |
RDR-THBS4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Thrombospondin 4 (THBS4) ELISA Kit |
RDR-THBS4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Thrombospondin 1 ELISA Kit (THBS1) |
RK02384 |
Abclonal |
96 Tests |
EUR 521 |
Human Thrombospondin 1 (THBS1) ELISA Kit |
RD-THBS1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Thrombospondin 1 (THBS1) ELISA Kit |
RD-THBS1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Thrombospondin 2 (THBS2) ELISA Kit |
RD-THBS2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 374 |
Human Thrombospondin 2 (THBS2) ELISA Kit |
RD-THBS2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 513 |
Human Thrombospondin 4 (THBS4) ELISA Kit |
RD-THBS4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Thrombospondin 4 (THBS4) ELISA Kit |
RD-THBS4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Thrombospondin 2 (THBS2) ELISA Kit |
SED822Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3147.61 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids. |
Human Thrombospondin 2 (THBS2) ELISA Kit |
SED822Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 346.86 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids. |
Human Thrombospondin 2 (THBS2) ELISA Kit |
SED822Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 452.66 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids. |
Human Thrombospondin 2 (THBS2) ELISA Kit |
SED822Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 1736.97 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids. |
Human Thrombospondin 2 (THBS2) ELISA Kit |
4-SED822Hu |
Cloud-Clone |
-
EUR 3198.00
-
EUR 1687.00
-
EUR 453.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 2 elisa. Alternative names of the recognized antigen: TSP2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 2 (THBS2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
SED824Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
SED824Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
SED824Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
SED824Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma. |
Human Thrombospondin 4 (THBS4) ELISA Kit |
4-SED824Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 4 elisa. Alternative names of the recognized antigen: TSP4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 4 (THBS4) in samples from Plasma with no significant corss-reactivity with analogues from other species. |
Human Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma. |
Human Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma. |
Human Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma. |
Human Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma. |
Human Thrombospondin 1 (THBS1) ELISA Kit |
4-SEA611Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 1 elisa. Alternative names of the recognized antigen: TSP1
- Thrombospondin-1p180
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 1 (THBS1) in samples from plasma with no significant corss-reactivity with analogues from other species. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Thbs3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4897004 |
ABM |
1.0 ug DNA |
EUR 154 |
Thbs3 3'UTR Luciferase Stable Cell Line |
TU120448 |
ABM |
1.0 ml |
Ask for price |
Human THBS3(Thrombospondin 3) ELISA Kit