Human THBS3(Thrombospondin 3) ELISA Kit

Human THBS3(Thrombospondin 3) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Thrombospondin 3 (THBS3) ELISA Kit
20-abx156876	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thrombospondin 3 (THBS3) ELISA Kit
abx259888-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Thrombospondin- 3, THBS3 ELISA KIT
ELI-36583h	Lifescience Market	96 Tests	EUR 824

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
20-abx154756	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Thrombospondin- 3, Thbs3 ELISA KIT
ELI-17025m	Lifescience Market	96 Tests	EUR 865

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

Mouse Thrombospondin-3 (Thbs3)
1-CSB-EP023489MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 62.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli

Mouse Thrombospondin-3 (Thbs3)
1-CSB-YP023489MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 37.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast

Thrombospondin 3 (THBS3) Antibody
20-abx178573	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Thrombospondin 3 (THBS3) Antibody
20-abx178574	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx110655	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx110656	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx116967	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx123257	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx128997	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thrombospondin 3 (THBS3) Antibody
abx030681-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
abx030681-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
abx238675-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx320416	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
abx431668-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Recombinant Thrombospondin 3 (THBS3)
4-RPD823Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49746 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli

ELISA kit for Human THBS3 (Thrombospondin 3)
ELK5166	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thrombospondin 3 (THBS3) Protein
20-abx166577	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Thrombospondin 3 (THBS3) CLIA Kit
20-abx494398	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse THBS3 (Thrombospondin 3)
ELK6457	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Thrombospondin 3 (THBS3) CLIA Kit
20-abx494399	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human)
4-PAD823Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3)

Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106391	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106392	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107803	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107804	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109221	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109222	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Thrombospondin 3 (THBS3) Protein
20-abx655225	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Thrombospondin 3 (THBS3) Protein
20-abx655226	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC
4-PAD823Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated
4-PAD823Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3
4-PAD823Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC
4-PAD823Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP
4-PAD823Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE
4-PAD823Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7
4-PAD823Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7.

Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus)
AMM08184G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications:

THBS3 ELISA Kit (Human) (OKCD00691)
OKCD00691	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL

Thrombospondin 3 ELISA KIT|Human
EF003592	Lifescience Market	96 Tests	EUR 689

Thbs3 ELISA Kit (Mouse) (OKCD01781)
OKCD01781	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 25.3 pg/mL

Human Thrombospondin 3 (TSP-3)ELISA Kit
201-12-2387	SunredBio	96 tests	EUR 440
This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thrombospondin 3(TSP-3)ELISA Kit
QY-E00634	Qayee Biotechnology	96T	EUR 361

THBS3 antibody
70R-21720	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal THBS3 antibody

Thbs3 Antibody
1-CSB-PA023489DA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

Thbs3 Antibody
1-CSB-PA023489EA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

THBS3 Antibody
1-CSB-PA023489ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

THBS3 Antibody
1-CSB-PA023489GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

THBS3 siRNA
20-abx936680	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

THBS3 siRNA
20-abx936681	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human THBS3 shRNA Plasmid
20-abx954831	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

THBS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2368904	ABM	1.0 ug DNA	EUR 154

THBS3 cloning plasmid
CSB-CL023489HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1458 Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT Show more
Description: A cloning plasmid for the THBS3 gene.

Thbs3 Polyclonal Antibody
A57726	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Thbs3 Polyclonal Antibody
A57777	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

THBS3 Rabbit pAb
A3641-100ul	Abclonal	100 ul	EUR 308

THBS3 Rabbit pAb
A3641-200ul	Abclonal	200 ul	EUR 459

THBS3 Rabbit pAb
A3641-20ul	Abclonal	20 ul	EUR 183

THBS3 Rabbit pAb
A3641-50ul	Abclonal	50 ul	EUR 223

Anti-THBS3 antibody
STJ25845	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants.

Anti-THBS3 antibody
STJ71847	St John's Laboratory	100 µg	EUR 359

THBS3 ORF Vector (Human) (pORF)
ORF014707	ABM	1.0 ug DNA	EUR 354

FSH (Human Follicle-stimulating hormone) ELISA test
3	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

Human Thrombospondin-2 ELISA kit
LF-EK50605	Abfrontier	1×96T	EUR 648

Human Thrombospondin 1 ELISA kit
E01T0763-192T	BlueGene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit
E01T0763-48	BlueGene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit
E01T0763-96	BlueGene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Thbs3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4897004	ABM	1.0 ug DNA	EUR 154

THBS3 3'UTR Luciferase Stable Cell Line
TU025528	ABM	1.0 ml	EUR 1521

Thbs3 3'UTR Luciferase Stable Cell Line
TU120448	ABM	1.0 ml	Ask for price

Thbs3 3'UTR GFP Stable Cell Line
TU170448	ABM	1.0 ml	Ask for price

THBS3 3'UTR GFP Stable Cell Line
TU075528	ABM	1.0 ml	EUR 1521

Mouse THBS3 shRNA Plasmid
20-abx973102	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human THBS3(Thrombospondin 3) ELISA Kit