Human THBS3(Thrombospondin 3) ELISA Kit

Human THBS3(Thrombospondin 3) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Hu-48Tests 48 Tests
EUR 521

Human Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Hu-96Tests 96 Tests
EUR 723

Mouse Thrombospondin 3 (THBS3) ELISA Kit

DLR-THBS3-Mu-48T 48T
EUR 527
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

DLR-THBS3-Mu-96T 96T
EUR 688
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RDR-THBS3-Mu-48Tests 48 Tests
EUR 557

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RDR-THBS3-Mu-96Tests 96 Tests
EUR 774

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Mu-48Tests 48 Tests
EUR 533

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Mu-96Tests 96 Tests
EUR 740

Human Thrombospondin 3 (THBS3) ELISA Kit

20-abx156876
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 3 (THBS3) ELISA Kit

abx259888-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Thrombospondin- 3, THBS3 ELISA KIT

ELI-36583h 96 Tests
EUR 824

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

4-SED823Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

20-abx154756
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Thrombospondin- 3, Thbs3 ELISA KIT

ELI-17025m 96 Tests
EUR 865

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

4-SED823Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human THBS3 (Thrombospondin 3)

ELK5166 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thrombospondin 3 (THBS3) CLIA Kit

20-abx494398
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Thrombospondin-3 (Thbs3)

1-CSB-EP023489MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli

Mouse Thrombospondin-3 (Thbs3)

1-CSB-YP023489MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast

Thrombospondin 3 (THBS3) Antibody

20-abx178573
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Thrombospondin 3 (THBS3) Antibody

20-abx178574
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx110655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx110656
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx116967
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx123257
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx128997
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thrombospondin 3 (THBS3) Antibody

abx030681-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

abx030681-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

abx238675-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx320416
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

abx431668-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Recombinant Thrombospondin 3 (THBS3)

4-RPD823Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49746
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli

Human Thrombospondin 3 (THBS3) Protein

20-abx166577
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse THBS3 (Thrombospondin 3)

ELK6457 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Thrombospondin 3 (THBS3) CLIA Kit

20-abx494399
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Thrombospondin 3 (THBS3) Antibody (Biotin)

20-abx106391
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (Biotin)

20-abx106392
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)

20-abx107803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)

20-abx107804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)

20-abx109221
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)

20-abx109222
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Thrombospondin 3 (THBS3) Protein

20-abx655225
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Thrombospondin 3 (THBS3) Protein

20-abx655226
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human)

4-PAD823Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3)

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC

4-PAD823Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated

4-PAD823Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3

4-PAD823Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC

4-PAD823Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP

4-PAD823Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE

4-PAD823Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7

4-PAD823Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7.

Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus)

AMM08184G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications:

Thrombospondin 3 ELISA KIT|Human

EF003592 96 Tests
EUR 689

Human Thrombospondin 3 (TSP-3)ELISA Kit

201-12-2387 96 tests
EUR 440
  • This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thrombospondin 3(TSP-3)ELISA Kit

QY-E00634 96T
EUR 361

THBS3 antibody

70R-21720 50 ul
EUR 435
Description: Rabbit polyclonal THBS3 antibody

Thbs3 Antibody

1-CSB-PA023489DA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

Thbs3 Antibody

1-CSB-PA023489EA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

THBS3 Antibody

1-CSB-PA023489ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

THBS3 Antibody

1-CSB-PA023489GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

THBS3 siRNA

20-abx936680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

THBS3 siRNA

20-abx936681
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human THBS3 shRNA Plasmid

20-abx954831
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Thrombospondin 1 ELISA kit

E01T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit

E01T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit

E01T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin-2 ELISA kit

LF-EK50605 1×96T
EUR 648

THBS3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2368904 1.0 ug DNA
EUR 154

THBS3 cloning plasmid

CSB-CL023489HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1458
  • Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT
  • Show more
Description: A cloning plasmid for the THBS3 gene.

Thbs3 Polyclonal Antibody

A57726 100 µg
EUR 570.55
Description: fast delivery possible

Thbs3 Polyclonal Antibody

A57777 100 µg
EUR 570.55
Description: Ask the seller for details

THBS3 Rabbit pAb

A3641-100ul 100 ul
EUR 308

THBS3 Rabbit pAb

A3641-200ul 200 ul
EUR 459

THBS3 Rabbit pAb

A3641-20ul 20 ul
EUR 183

THBS3 Rabbit pAb

A3641-50ul 50 ul
EUR 223

Anti-THBS3 antibody

STJ25845 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants.

Anti-THBS3 antibody

STJ71847 100 µg
EUR 359

FSH (Human Follicle-stimulating hormone) ELISA test

3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

THBS3 ORF Vector (Human) (pORF)

ORF014707 1.0 ug DNA
EUR 354

Human Thrombospondin 1 (THBS1) ELISA Kit

DLR-THBS1-Hu-48T 48T
EUR 479
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

DLR-THBS1-Hu-96T 96T
EUR 621
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.

Human Thrombospondin 2 (THBS2) ELISA Kit

DLR-THBS2-Hu-48T 48T
EUR 387
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

DLR-THBS2-Hu-96T 96T
EUR 494
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 4 (THBS4) ELISA Kit

DLR-THBS4-Hu-48T 48T
EUR 517
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 4 (THBS4) ELISA Kit

DLR-THBS4-Hu-96T 96T
EUR 673
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.

Human Thrombospondin-2(THBS2) ELISA kit

CSB-EL023488HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thrombospondin-2(THBS2) ELISA kit

1-CSB-EL023488HU
  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thrombospondin-4(THBS4) ELISA kit

CSB-EL023490HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4 (THBS4) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thrombospondin-4(THBS4) ELISA kit

1-CSB-EL023490HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4(THBS4) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thrombospondin 1(THBS1) ELISA kit

E01T0686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1(THBS1) ELISA kit

E01T0686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1(THBS1) ELISA kit

E01T0686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit

E01T0687-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit

E01T0687-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit

E01T0687-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin-2 (JAK2) ELISA Kit

abx050226-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

abx052577-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

20-abx153283
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit

20-abx153284
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit

20-abx153285
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit

abx253753-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit

abx250162-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

abx253325-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit

abx253326-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human THBS1/ Thrombospondin-1 ELISA Kit

E2490Hu 1 Kit
EUR 537

Human THBS2/ Thrombospondin-2 ELISA Kit

E2491Hu 1 Kit
EUR 537

Human THBS4/ Thrombospondin-4 ELISA Kit

E2492Hu 1 Kit
EUR 571

Human THBS4(Thrombospondin-4) ELISA Kit

EH0795 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35443
  • Alias: TSP-4(Thrombospondin-4)/THBS4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Thrombospondin- 1, THBS1 ELISA KIT

ELI-02195h 96 Tests
EUR 824

Human Thrombospondin- 2, THBS2 ELISA KIT

ELI-06100h 96 Tests
EUR 824

Human Thrombospondin 4 (THBS4) ELISA Kit

abx571192-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

abx571959-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit

abx576059-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thrombospondin-2 ELISA kit (4X96T)

LF-EK50606 4×96T
EUR 2201

Human Thrombospondin 1 (THBS1) ELISA Kit

RDR-THBS1-Hu-48Tests 48 Tests
EUR 500

Human Thrombospondin 1 (THBS1) ELISA Kit

RDR-THBS1-Hu-96Tests 96 Tests
EUR 692

Human Thrombospondin 2 (THBS2) ELISA Kit

RDR-THBS2-Hu-48Tests 48 Tests
EUR 390

Human Thrombospondin 2 (THBS2) ELISA Kit

RDR-THBS2-Hu-96Tests 96 Tests
EUR 536

Human Thrombospondin 4 (THBS4) ELISA Kit

RDR-THBS4-Hu-48Tests 48 Tests
EUR 544

Human Thrombospondin 4 (THBS4) ELISA Kit

RDR-THBS4-Hu-96Tests 96 Tests
EUR 756

Human Thrombospondin 1 ELISA Kit (THBS1)

RK02384 96 Tests
EUR 521

Human Thrombospondin 1 (THBS1) ELISA Kit

RD-THBS1-Hu-48Tests 48 Tests
EUR 478

Human Thrombospondin 1 (THBS1) ELISA Kit

RD-THBS1-Hu-96Tests 96 Tests
EUR 662

Human Thrombospondin 2 (THBS2) ELISA Kit

RD-THBS2-Hu-48Tests 48 Tests
EUR 374

Human Thrombospondin 2 (THBS2) ELISA Kit

RD-THBS2-Hu-96Tests 96 Tests
EUR 513

Human Thrombospondin 4 (THBS4) ELISA Kit

RD-THBS4-Hu-48Tests 48 Tests
EUR 521

Human Thrombospondin 4 (THBS4) ELISA Kit

RD-THBS4-Hu-96Tests 96 Tests
EUR 723

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-10x96wellstestplate 10x96-wells test plate
EUR 3147.61
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-1x48wellstestplate 1x48-wells test plate
EUR 346.86
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-1x96wellstestplate 1x96-wells test plate
EUR 452.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-5x96wellstestplate 5x96-wells test plate
EUR 1736.97
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

4-SED822Hu
  • EUR 3198.00
  • EUR 1687.00
  • EUR 453.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 2 elisa. Alternative names of the recognized antigen: TSP2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 2 (THBS2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

4-SED824Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 4 elisa. Alternative names of the recognized antigen: TSP4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 4 (THBS4) in samples from Plasma with no significant corss-reactivity with analogues from other species.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

4-SEA611Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 1 elisa. Alternative names of the recognized antigen: TSP1
  • Thrombospondin-1p180
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 1 (THBS1) in samples from plasma with no significant corss-reactivity with analogues from other species.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Thbs3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4897004 1.0 ug DNA
EUR 154

Thbs3 3'UTR Luciferase Stable Cell Line

TU120448 1.0 ml Ask for price

Thbs3 3'UTR GFP Stable Cell Line

TU170448 1.0 ml Ask for price

Human THBS3(Thrombospondin 3) ELISA Kit