Human KTN1(Kinectin 1) ELISA Kit
To Order Contact us below: zachary@wildpalm.net
Human Kinectin 1 (KTN1) ELISA Kit |
SEC558Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Kinectin 1 (KTN1) ELISA Kit |
SEC558Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Kinectin 1 (KTN1) ELISA Kit |
SEC558Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Kinectin 1 (KTN1) ELISA Kit |
4-SEC558Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kinectin 1 elisa. Alternative names of the recognized antigen: CG1
- KNT
- Kinesin Receptor
- CG-1 antigen
- Kinesin receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kinectin 1 (KTN1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Kinectin 1 (KTN1) Antibody |
20-abx113377 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Antibody |
20-abx130873 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kinectin 1 (KTN1) Antibody |
20-abx130874 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kinectin 1 (KTN1) Antibody |
abx146420-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Antibody |
20-abx004510 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Antibody |
20-abx338653 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Antibody |
abx234660-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Kinectin 1 (KTN1) |
4-RPC558Hu01 |
Cloud-Clone |
-
EUR 444.06
-
EUR 222.00
-
EUR 1390.24
-
EUR 530.08
-
EUR 960.16
-
EUR 360.00
-
EUR 3325.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q86UP2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Kinectin 1 expressed in: E.coli |
Recombinant Kinectin 1 (KTN1) |
4-RPC558Ra01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D4A4Z9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Kinectin 1 expressed in: E.coli |
Human Kinectin 1 (KTN1) Protein |
20-abx650030 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1873.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Human KTN1 (Kinectin 1) |
ELK5160 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kinectin 1 (KTN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kinectin 1 (KTN1
- Show more
|
Description: A sandwich ELISA kit for detection of Kinectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Kinectin 1 (KTN1) CLIA Kit |
20-abx493764 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human Kinectin (KTN1) |
KTE61871-48T |
Abbkine |
48T |
EUR 332 |
- Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kinectin (KTN1) |
KTE61871-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kinectin (KTN1) |
KTE61871-96T |
Abbkine |
96T |
EUR 539 |
- Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Kinectin 1 (KTN1) Protein |
20-abx650031 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kinectin 1 (KTN1) Antibody (HRP) |
20-abx336246 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Antibody (FITC) |
20-abx336247 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Antibody (Biotin) |
20-abx336248 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig) |
4-PAC558Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1) |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat) |
4-PAC558Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1) |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC |
4-PAC558Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAC558Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Biotin. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAC558Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Cy3. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), FITC |
4-PAC558Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with FITC. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), HRP |
4-PAC558Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with HRP. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), PE |
4-PAC558Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with PE. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC |
4-PAC558Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAC558Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Biotin. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAC558Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Cy3. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), FITC |
4-PAC558Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with FITC. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), HRP |
4-PAC558Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with HRP. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), PE |
4-PAC558Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with PE. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAC558Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7. |
Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAC558Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Kinectin 1 antibody |
70R-6709 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Kinectin 1 antibody |
KTN1 ELISA Kit (Human) (OKCD01205) |
OKCD01205 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Receptor for kinesin thus involved in kinesin-driven vesicle motility. Accumulates in integrin-based adhesion complexes (IAC) upon integrin aggregation by fibronectin. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 30 pg/mL |
Recombinant human Kinectin |
P2662 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q86UP2
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Kinectin |
Kinectin 1 Blocking Peptide |
33R-2373 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KTN1 antibody, catalog no. 70R-6709 |
KTN1 siRNA |
20-abx922172 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KTN1 siRNA |
20-abx922173 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KTN1 antibody |
38704-100ul |
SAB |
100ul |
EUR 252 |
KTN1 antibody |
70R-18197 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal KTN1 antibody |
KTN1 Antibody |
1-CSB-PA012700GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
KTN1 Antibody |
1-CSB-PA773030LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Human KTN1 shRNA Plasmid |
20-abx952639 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
KTN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1191202 |
ABM |
1.0 ug DNA |
EUR 154 |
KTN1 Conjugated Antibody |
C38704 |
SAB |
100ul |
EUR 397 |
anti- KTN1 antibody |
FNab04660 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: kinectin 1 (kinesin receptor)
- Uniprot ID: Q86UP2
- Gene ID: 3895
- Research Area: Signal Transduction
|
Description: Antibody raised against KTN1 |
KTN1 Rabbit pAb |
A12456-100ul |
Abclonal |
100 ul |
EUR 308 |
KTN1 Rabbit pAb |
A12456-200ul |
Abclonal |
200 ul |
EUR 459 |
KTN1 Rabbit pAb |
A12456-20ul |
Abclonal |
20 ul |
EUR 183 |
KTN1 Rabbit pAb |
A12456-50ul |
Abclonal |
50 ul |
EUR 223 |
KTN1 Rabbit pAb |
A5879-100ul |
Abclonal |
100 ul |
EUR 308 |
KTN1 Rabbit pAb |
A5879-200ul |
Abclonal |
200 ul |
EUR 459 |
KTN1 Rabbit pAb |
A5879-20ul |
Abclonal |
20 ul |
EUR 183 |
KTN1 Rabbit pAb |
A5879-50ul |
Abclonal |
50 ul |
EUR 223 |
KTN1 Rabbit pAb |
A14016-100ul |
Abclonal |
100 ul |
EUR 308 |
KTN1 Rabbit pAb |
A14016-200ul |
Abclonal |
200 ul |
EUR 459 |
KTN1 Rabbit pAb |
A14016-20ul |
Abclonal |
20 ul |
EUR 183 |
KTN1 Rabbit pAb |
A14016-50ul |
Abclonal |
50 ul |
EUR 223 |
KTN1 Polyclonal Antibody |
A69971 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
KTN1 cloning plasmid |
CSB-CL773030HU-10ug |
Cusabio |
10ug |
EUR 1377 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3921
- Sequence: atggagttttatgagtcagcatattttattgttcttattccttcaatagttattacagtaattttcctcttcttctggcttttcatgaaagaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagcttattcctaccaaaacagataaaaagaaagcagaaa
- Show more
|
Description: A cloning plasmid for the KTN1 gene. |
Anti-KTN1 antibody |
STJ28152 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene. |
Anti-KTN1 antibody |
STJ114330 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene. |
Anti-KTN1 antibody |
STJ115951 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene. |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
KTN1 ORF Vector (Human) (pORF) |
ORF013543 |
ABM |
1.0 ug DNA |
EUR 354 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse KTN1 shRNA Plasmid |
20-abx971260 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KTN1 Antibody, HRP conjugated |
1-CSB-PA773030LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
KTN1 Antibody, FITC conjugated |
1-CSB-PA773030LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
KTN1 Antibody, Biotin conjugated |
1-CSB-PA773030LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Ktn1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4810402 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
KTN1 sgRNA CRISPR Lentivector set (Human) |
K1191201 |
ABM |
3 x 1.0 ug |
EUR 339 |
KTN1-AS1 ORF Vector (Human) (pORF) |
ORF022577 |
ABM |
1.0 ug DNA |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit |
EI2301-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit |
EP1100-1 |
AssayPro |
96 Well Plate |
EUR 417 |
KTN1 Polyclonal Antibody, HRP Conjugated |
A69972 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
KTN1 Polyclonal Antibody, FITC Conjugated |
A69973 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
KTN1 Polyclonal Antibody, Biotin Conjugated |
A69974 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
Ktn1 ORF Vector (Mouse) (pORF) |
ORF048908 |
ABM |
1.0 ug DNA |
EUR 506 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
KTN1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1191203 |
ABM |
1.0 ug DNA |
EUR 154 |
KTN1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1191204 |
ABM |
1.0 ug DNA |
EUR 154 |
KTN1 Protein Vector (Human) (pPB-C-His) |
PV054169 |
ABM |
500 ng |
EUR 481 |
KTN1 Protein Vector (Human) (pPB-N-His) |
PV054170 |
ABM |
500 ng |
EUR 481 |
KTN1 Protein Vector (Human) (pPM-C-HA) |
PV054171 |
ABM |
500 ng |
EUR 481 |
KTN1 Protein Vector (Human) (pPM-C-His) |
PV054172 |
ABM |
500 ng |
EUR 481 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit |
EG2350-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit |
EG3928-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit |
EC5752-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5101-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit |
EA5501-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit |
EE2702-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit |
EM5110-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit |
EH5215-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human KTN1(Kinectin 1) ELISA Kit