Human FNTa(Farnesyltransferase Alpha) ELISA Kit

Human FNTa(Farnesyltransferase Alpha) ELISA Kit

To Order Contact us below:

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Farnesyltransferase Alpha elisa. Alternative names of the recognized antigen: FPTA
  • PTAR2
  • PGGT1A
  • Protein Prenyltransferase Alpha Subunit Repeat Containing 2
  • CAAX farnesyltransferase subunit alpha
  • Ras proteins prenyltransferase subun
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Alpha (FNTa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Farnesyltransferase Alpha (FNTA) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Farnesyltransferase Alpha (FNTa) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Farnesyltransferase Alpha (FNTA) Antibody

abx031598-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031598-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031599-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031599-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx233180-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Farnesyltransferase Alpha (FNTa)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49354
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.7KDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Farnesyltransferase Alpha expressed in: E.coli

Human Farnesyltransferase Alpha (FNTa) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Farnesyltransferase alpha (FNTa) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human FNTa (Farnesyltransferase Alpha)

ELK4902 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Alpha (FNT?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to F
  • Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa)

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Biotin.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Cy3.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with FITC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with HRP.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with PE.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC-Cy7.

Fnta/ Rat Fnta ELISA Kit

ELI-47317r 96 Tests
EUR 886

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


ELI-26701h 96 Tests
EUR 824


EF009665 96 Tests
EUR 689

FNTA ELISA Kit (Human) (OKCD00703)

OKCD00703 96 Wells
EUR 831
Description: Description of target: Essential subunit of both the farnesyltransferase and the geranylgeranyltransferase complex. Contributes to the transfer of a farnesyl or geranylgeranyl moiety from farnesyl or geranylgeranyl diphosphate to a cysteine at the fourth position from the C-terminus of several proteins having the C-terminal sequence Cys-aliphatic-aliphatic-X. May positively regulate neuromuscular junction development downstream of MUSK via its function in RAC1 prenylation and activation.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Mutational analysis of alpha-subunit of protein farnesyltransferase. Evidence for a catalytic role."_x005F_x005F_x000D_Andres D.A., Goldstein J.L., Ho Y.K., Brown M.S._x005F_x005F_x000D_J. Biol. Chem. 268:1383-1390(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF LYS-164, FUNCTION, CATALYTIC ACTIVITY, SUBUNIT.Ref.3"Characterization of recombinant human farnesyl-protein transferase: cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases."_x005F_x005F_x000D_Omer C.A., Kral A.M., Diehl R.E., Prendergast G.C., Powers S., Allen C.M., Gibbs J.B., Kohl N.E._x005F_x005F_x000D_Biochemistry 32:5167-5176(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF ASN-199, CATALYTIC ACTIVITY, FUNCTION.Ref.16"3-aminopyrrolidinone farnesyltransferase inhibitors: design of macrocyclic compounds with improved pharmacokinetics and excellent cell potency."_x005F_x005F_x000D_Bell I.M., Gallicchio S.N., Abrams M., Beese L.S., Beshore D.C., Bhimnathwala H., Bogusky M.J., Buser C.A., Culberson J.C., Davide J., Ellis-Hutchings M., Fernandes C., Gibbs J.B., Graham S.L., Hamilton K.A., Hartman G.D., Heimbrook D.C., Homnick C.F. , Huber H.E., Huff J.R., Kassahun K., Koblan K.S., Kohl N.E., Lobell R.B., Lynch J.J. Jr., Robinson R., Rodrigues A.D., Taylor J.S., Walsh E.S., Williams T.M., Zartman C.B._x005F_x005F_x000D_J. Med. Chem. 45:2388-2409(2002) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.17"Dual protein farnesyltransferase-geranylgeranyltransferase-I inhibitors as potential cancer chemotherapeutic agents."_x005F_x005F_x000D_deSolms S.J., Ciccarone T.M., MacTough S.C., Shaw A.W., Buser C.A., Ellis-Hutchings M., Fernandes C., Hamilton K.A., Huber H.E., Kohl N.E., Lobell R.B., Robinson R.G., Tsou N.N., Walsh E.S., Graham S.L., Beese L.S., Taylor J.S._x005F_x005F_x000D_J. Med. Chem. 46:2973-2984(2003) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.20"Conversion of protein farnesyltransferase to a geranylgeranyltransferase."_x005F_x005F_x000D_Terry K.L., Casey P.J., Beese L.S._x005F_x005F_x000D_Biochemistry 45:9746-9755(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.50 ANGSTROMS) IN COMPLEX WITH FNTB, FUNCTION, SUBUNIT, CATALYTIC ACTIVITY.Ref.21"Structural basis for binding and selectivity of antimalarial and anticancer ethylenediamine inhibitors to protein farnesyltransferase."_x005F_x005F_x000D_Hast M.A., Fletcher S., Cummings C.G., Pusateri E.E., Blaskovich M.A., Rivas K., Gelb M.H., Van Voorhis W.C., Sebti S.M., Hamilton A.D., Beese L.S._x005F_x005F_x000D_Chem. Biol. 16:181-192(2009) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.80 ANGSTROMS) OF 1-379 IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL


ELI-07852b 96 Tests
EUR 928

Mouse Fnta ELISA KIT

ELI-07853m 96 Tests
EUR 865

Human Farnesyltransferase Beta (FNTb) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Farnesyltransferase Beta(FNTb)ELISA Kit

QY-E03677 96T
EUR 361

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Farnesyltransferase Beta elisa. Alternative names of the recognized antigen: FPTB
  • CAAX farnesyltransferase subunit beta
  • Ras proteins prenyltransferase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Beta (FNTb) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant human FNTA

P1431 100ug Ask for price
  • Uniprot ID: P49354
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FNTA

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FNTb (Farnesyltransferase Beta)

ELK5384 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Beta (FNTb). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fa
  • Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

FNTA antibody

70R-17339 50 ul
EUR 435
Description: Rabbit polyclonal FNTA antibody

FNTA antibody

70R-1202 100 ug
EUR 377
Description: Rabbit polyclonal FNTA antibody raised against the C terminal of FNTA

FNTA antibody

70R-2956 50 ug
EUR 467
Description: Rabbit polyclonal FNTA antibody raised against the N terminal of FNTA

FNTA Antibody

36174-100ul 100ul
EUR 252

FNTA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FNTA Antibody

DF8125 200ul
EUR 304
Description: FNTA Antibody detects endogenous levels of total FNTA.

FNTA Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FNTA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FNTA Antibody

ABD8125 100 ug
EUR 438


YF-PA11835 50 ul
EUR 363
Description: Mouse polyclonal to FNTA


YF-PA11836 50 ul
EUR 363
Description: Mouse polyclonal to FNTA


YF-PA11837 50 ug
EUR 363
Description: Mouse polyclonal to FNTA

Human FNTA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FNTA Recombinant Protein (Human)

RP012424 100 ug Ask for price

FNTA Recombinant Protein (Human)

RP039253 100 ug Ask for price

Human farnesyl-diphosphate farnesyltransferase 1,FDFT1 ELISA Kit

201-12-0752 96 tests
EUR 440
  • This farnesyl-diphosphate farnesyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx252452-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human fFDFT1(Farnesyl Diphosphate Farnesyltransferase 1) ELISA Kit

EH3056 96T
EUR 524.1
  • Detection range: 1.563-100mIU/ml
  • Alias: fFDFT1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938mU/ml

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

GA-E0768HM-48T 48T
EUR 289

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

GA-E0768HM-96T 96T
EUR 466

Human Protein farnesyltransferase subunit beta, FNTB ELISA KIT

ELI-32519h 96 Tests
EUR 824

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

QY-E03679 96T
EUR 361

Human Farnesyltransferase Beta (FNTb) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FNTA Blocking Peptide

33R-2083 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-1202

FNTA Blocking Peptide

33R-5613 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-2956

FNTA Blocking Peptide

DF8125-BP 1mg
EUR 195

FNTA Conjugated Antibody

C36174 100ul
EUR 397

FNTA cloning plasmid

CSB-CL008777HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgtcctgtacagttagagatgtttatgattacttccgagctgtcctgcagcgtgatgaaagaagtgaacgagcttttaagctaacccgggatgctattgagttaaatgcagccaattatacagtgtggcatttccggagagttcttttgaagtcacttcagaaggatctacatga
  • Show more
Description: A cloning plasmid for the FNTA gene.

FNTA cloning plasmid

CSB-CL008777HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Show more
Description: A cloning plasmid for the FNTA gene.

Human FNTa(Farnesyltransferase Alpha) ELISA Kit