Human FNTa(Farnesyltransferase Alpha) ELISA Kit

Human FNTa(Farnesyltransferase Alpha) ELISA Kit

To Order Contact us below:

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Farnesyltransferase Alpha elisa. Alternative names of the recognized antigen: FPTA
  • PTAR2
  • PGGT1A
  • Protein Prenyltransferase Alpha Subunit Repeat Containing 2
  • CAAX farnesyltransferase subunit alpha
  • Ras proteins prenyltransferase subun
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Alpha (FNTa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Farnesyltransferase Alpha (FNTA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031598-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031598-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031599-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031599-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Farnesyltransferase Alpha (FNTA) Antibody

abx233180-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Farnesyltransferase Alpha (FNTa)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49354
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.7KDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Farnesyltransferase Alpha expressed in: E.coli

Human Farnesyltransferase Alpha (FNTa) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Farnesyltransferase alpha (FNTa) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human FNTa (Farnesyltransferase Alpha)

ELK4902 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Alpha (FNT?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to F
  • Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa)

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Biotin.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Cy3.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with FITC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with HRP.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with PE.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FNTa (Met51~Lys366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC-Cy7.

Fnta/ Rat Fnta ELISA Kit

ELI-47317r 96 Tests
EUR 886

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


ELI-26701h 96 Tests
EUR 824


EF009665 96 Tests
EUR 689

FNTA ELISA Kit (Human) (OKCD00703)

OKCD00703 96 Wells
EUR 831
Description: Description of target: Essential subunit of both the farnesyltransferase and the geranylgeranyltransferase complex. Contributes to the transfer of a farnesyl or geranylgeranyl moiety from farnesyl or geranylgeranyl diphosphate to a cysteine at the fourth position from the C-terminus of several proteins having the C-terminal sequence Cys-aliphatic-aliphatic-X. May positively regulate neuromuscular junction development downstream of MUSK via its function in RAC1 prenylation and activation.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Mutational analysis of alpha-subunit of protein farnesyltransferase. Evidence for a catalytic role."_x005F_x005F_x000D_Andres D.A., Goldstein J.L., Ho Y.K., Brown M.S._x005F_x005F_x000D_J. Biol. Chem. 268:1383-1390(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF LYS-164, FUNCTION, CATALYTIC ACTIVITY, SUBUNIT.Ref.3"Characterization of recombinant human farnesyl-protein transferase: cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases."_x005F_x005F_x000D_Omer C.A., Kral A.M., Diehl R.E., Prendergast G.C., Powers S., Allen C.M., Gibbs J.B., Kohl N.E._x005F_x005F_x000D_Biochemistry 32:5167-5176(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF ASN-199, CATALYTIC ACTIVITY, FUNCTION.Ref.16"3-aminopyrrolidinone farnesyltransferase inhibitors: design of macrocyclic compounds with improved pharmacokinetics and excellent cell potency."_x005F_x005F_x000D_Bell I.M., Gallicchio S.N., Abrams M., Beese L.S., Beshore D.C., Bhimnathwala H., Bogusky M.J., Buser C.A., Culberson J.C., Davide J., Ellis-Hutchings M., Fernandes C., Gibbs J.B., Graham S.L., Hamilton K.A., Hartman G.D., Heimbrook D.C., Homnick C.F. , Huber H.E., Huff J.R., Kassahun K., Koblan K.S., Kohl N.E., Lobell R.B., Lynch J.J. Jr., Robinson R., Rodrigues A.D., Taylor J.S., Walsh E.S., Williams T.M., Zartman C.B._x005F_x005F_x000D_J. Med. Chem. 45:2388-2409(2002) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.17"Dual protein farnesyltransferase-geranylgeranyltransferase-I inhibitors as potential cancer chemotherapeutic agents."_x005F_x005F_x000D_deSolms S.J., Ciccarone T.M., MacTough S.C., Shaw A.W., Buser C.A., Ellis-Hutchings M., Fernandes C., Hamilton K.A., Huber H.E., Kohl N.E., Lobell R.B., Robinson R.G., Tsou N.N., Walsh E.S., Graham S.L., Beese L.S., Taylor J.S._x005F_x005F_x000D_J. Med. Chem. 46:2973-2984(2003) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.20"Conversion of protein farnesyltransferase to a geranylgeranyltransferase."_x005F_x005F_x000D_Terry K.L., Casey P.J., Beese L.S._x005F_x005F_x000D_Biochemistry 45:9746-9755(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.50 ANGSTROMS) IN COMPLEX WITH FNTB, FUNCTION, SUBUNIT, CATALYTIC ACTIVITY.Ref.21"Structural basis for binding and selectivity of antimalarial and anticancer ethylenediamine inhibitors to protein farnesyltransferase."_x005F_x005F_x000D_Hast M.A., Fletcher S., Cummings C.G., Pusateri E.E., Blaskovich M.A., Rivas K., Gelb M.H., Van Voorhis W.C., Sebti S.M., Hamilton A.D., Beese L.S._x005F_x005F_x000D_Chem. Biol. 16:181-192(2009) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.80 ANGSTROMS) OF 1-379 IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL


ELI-07852b 96 Tests
EUR 928

Mouse Fnta ELISA KIT

ELI-07853m 96 Tests
EUR 865

Human Farnesyltransferase Beta (FNTb) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Farnesyltransferase Beta(FNTb)ELISA Kit

QY-E03677 96T
EUR 361

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Farnesyltransferase Beta elisa. Alternative names of the recognized antigen: FPTB
  • CAAX farnesyltransferase subunit beta
  • Ras proteins prenyltransferase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Beta (FNTb) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant human FNTA

P1431 100ug Ask for price
  • Uniprot ID: P49354
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FNTA

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FNTb (Farnesyltransferase Beta)

ELK5384 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Beta (FNTb). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fa
  • Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FNTA Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FNTA antibody

70R-2956 50 ug
EUR 467
Description: Rabbit polyclonal FNTA antibody raised against the N terminal of FNTA

FNTA Antibody

ABD8125 100 ug
EUR 438

FNTA Antibody

36174-100ul 100ul
EUR 252

FNTA antibody

70R-17339 50 ul
EUR 435
Description: Rabbit polyclonal FNTA antibody

FNTA antibody

70R-1202 100 ug
EUR 377
Description: Rabbit polyclonal FNTA antibody raised against the C terminal of FNTA

FNTA Antibody

DF8125 200ul
EUR 304
Description: FNTA Antibody detects endogenous levels of total FNTA.

FNTA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FNTA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100


YF-PA11835 50 ul
EUR 363
Description: Mouse polyclonal to FNTA


YF-PA11836 50 ul
EUR 363
Description: Mouse polyclonal to FNTA


YF-PA11837 50 ug
EUR 363
Description: Mouse polyclonal to FNTA

Human FNTA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FNTA Recombinant Protein (Human)

RP012424 100 ug Ask for price

FNTA Recombinant Protein (Human)

RP039253 100 ug Ask for price

Human fFDFT1(Farnesyl Diphosphate Farnesyltransferase 1) ELISA Kit

EH3056 96T
EUR 524.1
  • Detection range: 1.563-100mIU/ml
  • Alias: fFDFT1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938mU/ml

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

GA-E0768HM-48T 48T
EUR 289

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

GA-E0768HM-96T 96T
EUR 466

Human Protein farnesyltransferase subunit beta, FNTB ELISA KIT

ELI-32519h 96 Tests
EUR 824

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx252452-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human farnesyl-diphosphate farnesyltransferase 1,FDFT1 ELISA Kit

201-12-0752 96 tests
EUR 440
  • This farnesyl-diphosphate farnesyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

QY-E03679 96T
EUR 361

Human Farnesyltransferase Beta (FNTb) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FNTA Conjugated Antibody

C36174 100ul
EUR 397

FNTA cloning plasmid

CSB-CL008777HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgtcctgtacagttagagatgtttatgattacttccgagctgtcctgcagcgtgatgaaagaagtgaacgagcttttaagctaacccgggatgctattgagttaaatgcagccaattatacagtgtggcatttccggagagttcttttgaagtcacttcagaaggatctacatga
  • Show more
Description: A cloning plasmid for the FNTA gene.

FNTA cloning plasmid

CSB-CL008777HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Show more
Description: A cloning plasmid for the FNTA gene.

anti- FNTA antibody

FNab03180 100µg
EUR 548.75
  • Immunogen: farnesyltransferase, CAAX box, alpha
  • Uniprot ID: P49354
  • Gene ID: 2339
  • Research Area: Metabolism
Description: Antibody raised against FNTA

FNTA Rabbit pAb

A8805-100ul 100 ul
EUR 308

FNTA Rabbit pAb

A8805-200ul 200 ul
EUR 459

FNTA Rabbit pAb

A8805-20ul 20 ul
EUR 183

FNTA Rabbit pAb

A8805-50ul 50 ul
EUR 223

FNTA Blocking Peptide

33R-5613 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-2956

FNTA Blocking Peptide

33R-2083 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-1202

FNTA Blocking Peptide

DF8125-BP 1mg
EUR 195

Anti-FNTA antibody

PAab03180 100 ug
EUR 386


PVT13509 2 ug
EUR 391

Anti-FNTA antibody

STJ111424 100 µl
EUR 277
Description: Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13.

ELISA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)

E-EL-H1250 1 plate of 96 wells
EUR 534
  • Gentaur's FDFT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

FNTA ORF Vector (Human) (pORF)

ORF004142 1.0 ug DNA
EUR 95

FNTA ORF Vector (Human) (pORF)

ORF013085 1.0 ug DNA
EUR 354

Human TNF-alpha ELISA Kit, 96 tests, Quantitative

100-215-TNH 1 kit
EUR 482

Monkey Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx359694-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx361477-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx362487-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E05F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E05F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E05F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein farnesyltransferase subunit beta, Fntb ELISA KIT

ELI-12899m 96 Tests
EUR 865

Bovine Protein farnesyltransferase subunit beta, FNTB ELISA KIT

ELI-30850b 96 Tests
EUR 928

Sheep Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx364435-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx356427-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Alpha Fetoprotein (AFP) ELISA Kit, 96 tests, Quantitative

500 1 kit
EUR 469

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human farnesyl- diphosphate farnesyltransferase 1, FDFT1 ELISA K

ELA-E1708h 96 Tests
EUR 824

Polyclonal FNTA Antibody (Center)

APR05040G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FNTA (Center). This antibody is tested and proven to work in the following applications:

Rat FNTA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FNTA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FNTA Recombinant Protein (Rat)

RP201626 100 ug Ask for price

FNTA Recombinant Protein (Mouse)

RP134963 100 ug Ask for price

Human Farnesyl Diphosphate Farnesyltransferase 1 (fFDFT1) CLIA Kit

abx196646-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx031594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx031594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx029024-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx029024-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx233181-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

FNTA sgRNA CRISPR Lentivector set (Human)

K0792801 3 x 1.0 ug
EUR 339

Mouse alpha 2-Macroglobulin (A2M) ELISA kit

600-720-A2M 1 Kit
EUR 773

Human Anti-Alpha Fodrin IgG ELISA kit, 96 tests, Quantitative

3300-160-AFG 1 kit
EUR 590

Human hypoxia-inducible transcription factor 1 alpha (HIF-1 alpha) ELISA Kit, 96 tests, Quantitative

100-530-HIF 1 Kit
EUR 712

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx357305-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Recombinant (E.Coli) Human p38 alpha/SAPK2 alpha

RP-675 1 ug
EUR 286

CLIA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)

E-CL-H0810 1 plate of 96 wells
EUR 584
  • Gentaur's FDFT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

Mouse TNF-alpha ELISA Kit, 96 tests, Quantitative

100-210-TNF 1 kit
EUR 482

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Polyclonal FNTA Antibody (C-term)

APR14336G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FNTA (C-term). This antibody is tested and proven to work in the following applications:

Fnta ORF Vector (Rat) (pORF)

ORF067210 1.0 ug DNA
EUR 506

Fnta ORF Vector (Mouse) (pORF)

ORF044989 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

FNTA sgRNA CRISPR Lentivector (Human) (Target 1)

K0792802 1.0 ug DNA
EUR 154

Human FNTa(Farnesyltransferase Alpha) ELISA Kit