Human SRI(Sorcin) ELISA Kit

Human SRI(Sorcin) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Sorcin (SRI) ELISA Kit
abx555504-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Sorcin(SRI)ELISA Kit
QY-E02519 96T
EUR 361
Human Sorcin (SRI) ELISA Kit
SEH133Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.
Human Sorcin (SRI) ELISA Kit
SEH133Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.
Human Sorcin (SRI) ELISA Kit
SEH133Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.
Human Sorcin (SRI) ELISA Kit
SEH133Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.
Human Sorcin (SRI) ELISA Kit
4-SEH133Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sorcin elisa. Alternative names of the recognized antigen: SCN
  • CP-22
  • V19
  • 22 kDa protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sorcin (SRI) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Sri/ Sorcin ELISA Kit
E1413Mo 1 Kit
EUR 632
Mouse Sorcin, Sri ELISA KIT
ELI-53405m 96 Tests
EUR 865
Mouse Sorcin (SRI) ELISA Kit
abx555639-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Sorcin (SRI) Antibody
20-abx006837
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sorcin (SRI) Antibody
20-abx115730
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sorcin (SRI) Antibody
20-abx131566
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sorcin (SRI) Antibody
20-abx141905
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sorcin (SRI) Antibody
20-abx174604
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Sorcin (SRI) Protein
20-abx261147
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Sorcin (SRI) Antibody
abx238228-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sorcin (SRI) Antibody
20-abx322137
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Sorcin (SRI)
4-RPH133Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P30626
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Sorcin expressed in: E.coli
ELISA kit for Human SRI (Sorcin)
ELK5034 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sorcin (SRI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sorcin (SRI). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Sorcin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Sorcin (SRI)
KTE60358-48T 48T
EUR 332
  • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Sorcin (SRI)
KTE60358-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Sorcin (SRI)
KTE60358-96T 96T
EUR 539
  • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Sorcin (SRI) CLIA Kit
20-abx495378
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Sorcin (SRI) Protein
20-abx650707
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Mouse Sorcin (SRI)
KTE70255-48T 48T
EUR 332
  • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Sorcin (SRI)
KTE70255-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Sorcin (SRI)
KTE70255-96T 96T
EUR 539
  • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Sri ELISA Kit| Mouse Sorcin ELISA Kit
EF016248 96 Tests
EUR 689
Sorcin (SRI) Polyclonal Antibody (Human)
4-PAH133Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI)
SRI Sorcin Human Recombinant Protein
PROTP30626 Regular: 20ug
EUR 317
Description: SRI Human Recombinant fused with a 23 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-198 a.a.) and having a molecular mass of 24.1kDa. The SRI is purified by proprietary chromatographic techniques.
Sorcin (SRI) Polyclonal Antibody (Human), APC
4-PAH133Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC.
Sorcin (SRI) Polyclonal Antibody (Human), Biotinylated
4-PAH133Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Biotin.
Sorcin (SRI) Polyclonal Antibody (Human), Cy3
4-PAH133Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Cy3.
Sorcin (SRI) Polyclonal Antibody (Human), FITC
4-PAH133Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with FITC.
Sorcin (SRI) Polyclonal Antibody (Human), HRP
4-PAH133Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with HRP.
Sorcin (SRI) Polyclonal Antibody (Human), PE
4-PAH133Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with PE.
Sorcin (SRI) Polyclonal Antibody (Human), APC-Cy7
4-PAH133Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC-Cy7.
Polyclonal SRI / Sorcin Antibody (aa50-100)
APR02437G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRI / Sorcin (aa50-100). This antibody is tested and proven to work in the following applications:
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-100ug
QP6727-ec-100ug 100ug
EUR 408
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-10ug
QP6727-ec-10ug 10ug
EUR 200
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-1mg
QP6727-ec-1mg 1mg
EUR 1632
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-200ug
QP6727-ec-200ug 200ug
EUR 634
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-500ug
QP6727-ec-500ug 500ug
EUR 1060
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-50ug
QP6727-ec-50ug 50ug
EUR 263
SRI ELISA KIT|Human
EF003232 96 Tests
EUR 689
ELISA kit for Human Sorcin
EK3730 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Mouse Sorcin
EK3729 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.
Recombinant Human Sorcin
7-06526 5µg Ask for price
Recombinant Human Sorcin
7-06527 20µg Ask for price
Recombinant Human Sorcin
7-06528 1mg Ask for price
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
SRI antibody
70R-20520 50 ul
EUR 435
Description: Rabbit polyclonal SRI antibody
SRI Antibody
1-CSB-PA022665ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRI. Recognizes SRI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200
SRI Antibody
1-CSB-PA022665GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SRI. Recognizes SRI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SRI siRNA
20-abx935158
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SRI siRNA
20-abx935159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human SRI shRNA Plasmid
20-abx954586
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SRI Recombinant Protein (Human)
RP030076 100 ug Ask for price
SRI Polyclonal Antibody
42331-100ul 100ul
EUR 333
Anti-SRI Antibody
A00222 100ug/vial
EUR 334
SRI cloning plasmid
CSB-CL022665HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 597
  • Sequence: atggcgtacccggggcatcctggcgccggcggcgggtactacccaggcgggtatggaggggctcccggagggcctgcgtttcccggacaaactcaggatccgctgtatggttactttgctgctgtagctggacaggatgggcagatagatgctgatgaattgcagagatgtctgac
  • Show more
Description: A cloning plasmid for the SRI gene.
SRI Rabbit pAb
A6751-100ul 100 ul
EUR 308
SRI Rabbit pAb
A6751-200ul 200 ul
EUR 459
SRI Rabbit pAb
A6751-20ul 20 ul
EUR 183
SRI Rabbit pAb
A6751-50ul 50 ul
EUR 223
anti- SRI antibody
FNab08228 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: sorcin
  • Uniprot ID: P30626
  • Gene ID: 6717
  • Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against SRI
SRI-011381 (hydrochloride)
HY-100347A 50mg
EUR 1097
SRI 31215 (TFA)
HY-114363A 100mg
EUR 1887
Anti-SRI antibody
PAab08228 100 ug
EUR 386
Anti-SRI antibody
STJ11100797 100 µl
EUR 413
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.
Anti-SRI antibody
STJ28834 100 µl
EUR 277
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.
SRI ORF Vector (Human) (pORF)
ORF010026 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
SRI protein (His tag)
80R-1699 100 ug
EUR 305
Description: Purified recombinant Human SRI protein
SRI Polyclonal Conjugated Antibody
C42331 100ul
EUR 397
Mouse SRI shRNA Plasmid
20-abx980002
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SRI Recombinant Protein (Rat)
RP231044 100 ug Ask for price
Anti-SR1/SRI Antibody
RP1110 100ug/vial
EUR 294
SRI Recombinant Protein (Mouse)
RP175409 100 ug Ask for price
SRI Recombinant Protein (Mouse)
RP175412 100 ug Ask for price
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
SRI sgRNA CRISPR Lentivector set (Human)
K2285001 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
[KO Validated] SRI Rabbit pAb
A19921-100ul 100 ul
EUR 410
[KO Validated] SRI Rabbit pAb
A19921-200ul 200 ul
EUR 571
[KO Validated] SRI Rabbit pAb
A19921-20ul 20 ul
EUR 221
[KO Validated] SRI Rabbit pAb
A19921-50ul 50 ul
EUR 287
Sri ORF Vector (Rat) (pORF)
ORF077016 1.0 ug DNA
EUR 506
Sri ORF Vector (Mouse) (pORF)
ORF058471 1.0 ug DNA
EUR 506
Sri ORF Vector (Mouse) (pORF)
ORF058472 1.0 ug DNA
EUR 506
SRI sgRNA CRISPR Lentivector (Human) (Target 1)
K2285002 1.0 ug DNA
EUR 154
SRI sgRNA CRISPR Lentivector (Human) (Target 2)
K2285003 1.0 ug DNA
EUR 154
SRI sgRNA CRISPR Lentivector (Human) (Target 3)
K2285004 1.0 ug DNA
EUR 154
SRI Protein Vector (Human) (pPB-C-His)
PV040101 500 ng
EUR 329
SRI Protein Vector (Human) (pPB-N-His)
PV040102 500 ng
EUR 329
SRI Protein Vector (Human) (pPM-C-HA)
PV040103 500 ng
EUR 329
SRI Protein Vector (Human) (pPM-C-His)
PV040104 500 ng
EUR 329
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Sri sgRNA CRISPR Lentivector set (Rat)
K7508101 3 x 1.0 ug
EUR 339
Sri sgRNA CRISPR Lentivector set (Mouse)
K3050701 3 x 1.0 ug
EUR 339
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)
VAng-Cr3554-1mgEcoli 1 mg (E. coli)
EUR 3294
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.
Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)
VAng-Cr3554-500gEcoli 500 µg (E. coli)
EUR 2360
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.
Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)
VAng-Cr3554-50gEcoli 50 µg (E. coli)
EUR 1618
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
Sri sgRNA CRISPR Lentivector (Rat) (Target 1)
K7508102 1.0 ug DNA
EUR 154
Sri sgRNA CRISPR Lentivector (Rat) (Target 2)
K7508103 1.0 ug DNA
EUR 154
Sri sgRNA CRISPR Lentivector (Rat) (Target 3)
K7508104 1.0 ug DNA
EUR 154
Sri sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3050702 1.0 ug DNA
EUR 154
Sri sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3050703 1.0 ug DNA
EUR 154
Sri sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3050704 1.0 ug DNA
EUR 154
SRI Protein Vector (Rat) (pPB-C-His)
PV308062 500 ng
EUR 603
SRI Protein Vector (Rat) (pPB-N-His)
PV308063 500 ng
EUR 603
SRI Protein Vector (Rat) (pPM-C-HA)
PV308064 500 ng
EUR 603
SRI Protein Vector (Rat) (pPM-C-His)
PV308065 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPB-C-His)
PV233882 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPB-N-His)
PV233883 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPM-C-HA)
PV233884 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPM-C-His)
PV233885 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPB-C-His)
PV233886 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPB-N-His)
PV233887 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPM-C-HA)
PV233888 500 ng
EUR 603
SRI Protein Vector (Mouse) (pPM-C-His)
PV233889 500 ng
EUR 603
Sri 3'UTR Luciferase Stable Cell Line
TU119686 1.0 ml Ask for price
Sri 3'UTR GFP Stable Cell Line
TU169686 1.0 ml Ask for price
Sri 3'UTR Luciferase Stable Cell Line
TU221173 1.0 ml Ask for price
SRI 3'UTR GFP Stable Cell Line
TU074588 1.0 ml
EUR 1394
Sri 3'UTR GFP Stable Cell Line
TU271173 1.0 ml Ask for price
SRI 3'UTR Luciferase Stable Cell Line
TU024588 1.0 ml
EUR 1394

Human SRI(Sorcin) ELISA Kit