Human SRI(Sorcin) ELISA Kit
To Order Contact us below: zachary@wildpalm.net
Human Sorcin (SRI) ELISA Kit |
abx555504-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Sorcin (SRI) ELISA Kit |
SEH133Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids. |
Human Sorcin (SRI) ELISA Kit |
SEH133Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids. |
Human Sorcin (SRI) ELISA Kit |
SEH133Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids. |
Human Sorcin (SRI) ELISA Kit |
SEH133Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids. |
Human Sorcin (SRI) ELISA Kit |
4-SEH133Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Sorcin elisa. Alternative names of the recognized antigen: SCN
- CP-22
- V19
- 22 kDa protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sorcin (SRI) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Sri/ Sorcin ELISA Kit |
E1413Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Sorcin (SRI) ELISA Kit |
abx555639-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Sorcin (SRI) Antibody |
20-abx006837 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sorcin (SRI) Antibody |
20-abx115730 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sorcin (SRI) Antibody |
20-abx131566 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Sorcin (SRI) Antibody |
20-abx141905 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Sorcin (SRI) Antibody |
20-abx174604 |
Abbexa |
|
|
|
Sorcin (SRI) Protein |
20-abx261147 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Sorcin (SRI) Antibody |
abx238228-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sorcin (SRI) Antibody |
20-abx322137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Sorcin (SRI) |
4-RPH133Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P30626
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Sorcin expressed in: E.coli |
ELISA kit for Human SRI (Sorcin) |
ELK5034 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sorcin (SRI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sorcin (SRI). Next, A
- Show more
|
Description: A sandwich ELISA kit for detection of Sorcin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Sorcin (SRI) |
KTE60358-48T |
Abbkine |
48T |
EUR 332 |
- The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Sorcin (SRI) |
KTE60358-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Sorcin (SRI) |
KTE60358-96T |
Abbkine |
96T |
EUR 539 |
- The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Sorcin (SRI) CLIA Kit |
20-abx495378 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Sorcin (SRI) Protein |
20-abx650707 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse Sorcin (SRI) |
KTE70255-48T |
Abbkine |
48T |
EUR 332 |
- Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Sorcin (SRI) |
KTE70255-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Sorcin (SRI) |
KTE70255-96T |
Abbkine |
96T |
EUR 539 |
- Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Sorcin (SRI) Polyclonal Antibody (Human) |
4-PAH133Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI) |
SRI Sorcin Human Recombinant Protein |
PROTP30626 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: SRI Human Recombinant fused with a 23 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-198 a.a.) and having a molecular mass of 24.1kDa. The SRI is purified by proprietary chromatographic techniques. |
Sorcin (SRI) Polyclonal Antibody (Human), APC |
4-PAH133Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC. |
Sorcin (SRI) Polyclonal Antibody (Human), Biotinylated |
4-PAH133Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Biotin. |
Sorcin (SRI) Polyclonal Antibody (Human), Cy3 |
4-PAH133Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Cy3. |
Sorcin (SRI) Polyclonal Antibody (Human), FITC |
4-PAH133Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with FITC. |
Sorcin (SRI) Polyclonal Antibody (Human), HRP |
4-PAH133Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with HRP. |
Sorcin (SRI) Polyclonal Antibody (Human), PE |
4-PAH133Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with PE. |
Polyclonal SRI / Sorcin Antibody (aa50-100) |
APR02437G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRI / Sorcin (aa50-100). This antibody is tested and proven to work in the following applications: |
Sorcin (SRI) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH133Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRI (Gly29~Leu169)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC-Cy7. |
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-100ug |
QP6727-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-10ug |
QP6727-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-1mg |
QP6727-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-200ug |
QP6727-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-500ug |
QP6727-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human SRI/ Sorcin Protein, GST, E.coli-50ug |
QP6727-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
ELISA kit for Human Sorcin |
EK3730 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids. |
SRI ELISA Kit (Human) (OKCD01022) |
OKCD01022 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Calcium-binding protein that modulates excitation-contraction coupling in the heart. Contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Modulates the activity of RYR2 calcium channels.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.16"Molecular basis for the impaired function of the natural F112L sorcin mutant: X-ray crystal structure, calcium affinity, and interaction with annexin VII and the ryanodine receptor."_x005F_x005F_x000D_Franceschini S., Ilari A., Verzili D., Zamparelli C., Antaramian A., Rueda A., Valdivia H.H., Chiancone E., Colotti G._x005F_x005F_x000D_FASEB J. 22:295-306(2008) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.5 ANGSTROMS) OF MUTANT LEU-112, SUBUNIT, FUNCTION, CALCIUM-BINDING, INTERACTION WITH RYR2 AND ANXA7. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.119 ng/mL |
SRI ELISA Kit (Human) (OKEH03543) |
OKEH03543 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Calcium-binding protein that modulates excitation-contraction coupling in the heart. Contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Modulates the activity of RYR2 calcium channels.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.176 ng/mL |
ELISA kit for Mouse Sorcin |
EK3729 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
SRI antibody |
70R-20520 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SRI antibody |
SRI Antibody |
1-CSB-PA022665ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SRI. Recognizes SRI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
SRI Antibody |
1-CSB-PA022665GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SRI. Recognizes SRI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
SRI siRNA |
20-abx935158 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRI siRNA |
20-abx935159 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human SRI shRNA Plasmid |
20-abx954586 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SRI Recombinant Protein (Human) |
RP030076 |
ABM |
100 ug |
Ask for price |
SRI Polyclonal Antibody |
42331-100ul |
SAB |
100ul |
EUR 333 |
Anti-SRI Antibody |
A00222 |
BosterBio |
100ug/vial |
EUR 334 |
SRI cloning plasmid |
CSB-CL022665HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 597
- Sequence: atggcgtacccggggcatcctggcgccggcggcgggtactacccaggcgggtatggaggggctcccggagggcctgcgtttcccggacaaactcaggatccgctgtatggttactttgctgctgtagctggacaggatgggcagatagatgctgatgaattgcagagatgtctgac
- Show more
|
Description: A cloning plasmid for the SRI gene. |
SRI Rabbit pAb |
A6751-100ul |
Abclonal |
100 ul |
EUR 308 |
SRI Rabbit pAb |
A6751-200ul |
Abclonal |
200 ul |
EUR 459 |
SRI Rabbit pAb |
A6751-20ul |
Abclonal |
20 ul |
EUR 183 |
SRI Rabbit pAb |
A6751-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- SRI antibody |
FNab08228 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: sorcin
- Uniprot ID: P30626
- Gene ID: 6717
- Research Area: Neuroscience, Cardiovascular, Signal Transduction
|
Description: Antibody raised against SRI |
Anti-SRI antibody |
STJ11100797 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. |
Anti-SRI antibody |
STJ28834 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. |
SRI ORF Vector (Human) (pORF) |
ORF010026 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
SRI protein (His tag) |
80R-1699 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human SRI protein |
SRI Polyclonal Conjugated Antibody |
C42331 |
SAB |
100ul |
EUR 397 |
Mouse SRI shRNA Plasmid |
20-abx980002 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SRI Recombinant Protein (Rat) |
RP231044 |
ABM |
100 ug |
Ask for price |
Anti-SR1/SRI Antibody |
RP1110 |
BosterBio |
100ug/vial |
EUR 294 |
SRI Recombinant Protein (Mouse) |
RP175409 |
ABM |
100 ug |
Ask for price |
SRI Recombinant Protein (Mouse) |
RP175412 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
SRI sgRNA CRISPR Lentivector set (Human) |
K2285001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
[KO Validated] SRI Rabbit pAb |
A19921-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] SRI Rabbit pAb |
A19921-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] SRI Rabbit pAb |
A19921-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] SRI Rabbit pAb |
A19921-50ul |
Abclonal |
50 ul |
EUR 287 |
Sri ORF Vector (Rat) (pORF) |
ORF077016 |
ABM |
1.0 ug DNA |
EUR 506 |
Sri ORF Vector (Mouse) (pORF) |
ORF058471 |
ABM |
1.0 ug DNA |
EUR 506 |
Sri ORF Vector (Mouse) (pORF) |
ORF058472 |
ABM |
1.0 ug DNA |
EUR 506 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
SRI sgRNA CRISPR Lentivector (Human) (Target 1) |
K2285002 |
ABM |
1.0 ug DNA |
EUR 154 |
SRI sgRNA CRISPR Lentivector (Human) (Target 2) |
K2285003 |
ABM |
1.0 ug DNA |
EUR 154 |
SRI sgRNA CRISPR Lentivector (Human) (Target 3) |
K2285004 |
ABM |
1.0 ug DNA |
EUR 154 |
SRI Protein Vector (Human) (pPB-C-His) |
PV040101 |
ABM |
500 ng |
EUR 329 |
SRI Protein Vector (Human) (pPB-N-His) |
PV040102 |
ABM |
500 ng |
EUR 329 |
SRI Protein Vector (Human) (pPM-C-HA) |
PV040103 |
ABM |
500 ng |
EUR 329 |
SRI Protein Vector (Human) (pPM-C-His) |
PV040104 |
ABM |
500 ng |
EUR 329 |
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Sri sgRNA CRISPR Lentivector set (Rat) |
K7508101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sri sgRNA CRISPR Lentivector set (Mouse) |
K3050701 |
ABM |
3 x 1.0 ug |
EUR 339 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171) |
VAng-Cr3554-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3294 |
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein. |
Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171) |
VAng-Cr3554-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2360 |
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein. |
Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171) |
VAng-Cr3554-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1618 |
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein. |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Sri sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7508102 |
ABM |
1.0 ug DNA |
EUR 154 |
Sri sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7508103 |
ABM |
1.0 ug DNA |
EUR 154 |
Sri sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7508104 |
ABM |
1.0 ug DNA |
EUR 154 |
Sri sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3050702 |
ABM |
1.0 ug DNA |
EUR 154 |
Sri sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3050703 |
ABM |
1.0 ug DNA |
EUR 154 |
Sri sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3050704 |
ABM |
1.0 ug DNA |
EUR 154 |
SRI Protein Vector (Rat) (pPB-C-His) |
PV308062 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Rat) (pPB-N-His) |
PV308063 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Rat) (pPM-C-HA) |
PV308064 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Rat) (pPM-C-His) |
PV308065 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPB-C-His) |
PV233882 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPB-N-His) |
PV233883 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPM-C-HA) |
PV233884 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPM-C-His) |
PV233885 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPB-C-His) |
PV233886 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPB-N-His) |
PV233887 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPM-C-HA) |
PV233888 |
ABM |
500 ng |
EUR 603 |
SRI Protein Vector (Mouse) (pPM-C-His) |
PV233889 |
ABM |
500 ng |
EUR 603 |
Sri 3'UTR Luciferase Stable Cell Line |
TU119686 |
ABM |
1.0 ml |
Ask for price |
Sri 3'UTR GFP Stable Cell Line |
TU169686 |
ABM |
1.0 ml |
Ask for price |
Sri 3'UTR Luciferase Stable Cell Line |
TU221173 |
ABM |
1.0 ml |
Ask for price |
SRI 3'UTR GFP Stable Cell Line |
TU074588 |
ABM |
1.0 ml |
EUR 1394 |
Human SRI(Sorcin) ELISA Kit