Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
4-SEJ123Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
  • Fumarylacetoacetase
  • Tyrosinemia 1
  • Beta-diketonase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx026534-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx026534-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx005052
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx018095-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx018096-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx102858
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx102859
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx112607
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx036126-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx317985
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx232948-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx002320
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Fumarylacetoacetate Hydrolase (FAH)
4-RPJ123Hu01
  • EUR 517.54
  • EUR 241.00
  • EUR 1665.76
  • EUR 621.92
  • EUR 1143.84
  • EUR 409.00
  • EUR 4014.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16930
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli
Recombinant Fumarylacetoacetate Hydrolase (FAH)
4-RPJ123Hu02
  • EUR 517.54
  • EUR 241.00
  • EUR 1665.76
  • EUR 621.92
  • EUR 1143.84
  • EUR 409.00
  • EUR 4014.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16930
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli
Mouse Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
20-abx389353
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Fumarylacetoacetate Hydrolase (FAH) Protein
20-abx066699
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Human Fumarylacetoacetate Hydrolase (FAH) Protein
20-abx066700
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Human Fumarylacetoacetate Hydrolase (FAH) CLIA Kit
20-abx495621
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase)
ELK4894 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)
20-abx272420
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody (HRP)
20-abx303802
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody (FITC)
20-abx303803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)
20-abx303804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human)
4-PAJ123Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH)
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC
4-PAJ123Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Biotinylated
4-PAJ123Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Cy3
4-PAJ123Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), FITC
4-PAJ123Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), HRP
4-PAJ123Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), PE
4-PAJ123Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat)
4-PAJ123Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH)
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC-Cy7
4-PAJ123Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAJ123Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAJ123Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAJ123Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAJ123Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAJ123Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAJ123Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAJ123Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.
Anti-Fumarylacetoacetate hydrolase (3G2)
YF-MA12951 100 ug
EUR 363
Description: Mouse monoclonal to Fumarylacetoacetate hydrolase
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02743 5µg Ask for price
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02744 20µg Ask for price
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02745 1mg Ask for price
Fumarylacetoacetate Hydrolase Domain Containing 1 (Recombinant)
20-abx073193
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Fah/ Rat Fah ELISA Kit
ELI-47608r 96 Tests
EUR 886
FAH ELISA KIT|Human
EF009501 96 Tests
EUR 689
FAHD1 Fumarylacetoacetate Hydrolase Domain Containing 1 Human Recombinant Protein
PROTQ6P587 Regular: 20ug
EUR 317
Description: FAHD1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27kDa. The FAHD1 is purified by proprietary chromatographic techniques.
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody
abx030304-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody
abx030304-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2A (FAHD2A) Antibody
20-abx308897
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Fumarylacetoacetase, FAH ELISA KIT
ELI-09815h 96 Tests
EUR 824
FAH ELISA Kit (Human) (OKCD00555)
OKCD00555 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL
Mouse Fah/ Fumarylacetoacetase ELISA Kit
E0499Mo 1 Kit
EUR 632
Mouse Fumarylacetoacetase, Fah ELISA KIT
ELI-32960m 96 Tests
EUR 865
Bovine Fumarylacetoacetase, FAH ELISA KIT
ELI-38504b 96 Tests
EUR 928
FAH ELISA Kit (Mouse) (OKEH08226)
OKEH08226 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.048ng/mL
Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit
EF014986 96 Tests
EUR 689
FAH ELISA Kit| Bovine Fumarylacetoacetase ELISA Kit
EF011403 96 Tests
EUR 689
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
FAH antibody
70R-17200 50 ul
EUR 435
Description: Rabbit polyclonal FAH antibody
FAH antibody
70R-1062 100 ug
EUR 377
Description: Rabbit polyclonal FAH antibody
FAH antibody
70R-2625 50 ug
EUR 467
Description: Rabbit polyclonal FAH antibody
FAH antibody
39026-100ul 100ul
EUR 252
FAH Antibody
39846-100ul 100ul
EUR 390
FAH Antibody
1-CSB-PA007965GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
FAH Antibody
1-CSB-PA007965LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
FAH siRNA
20-abx901829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FAH siRNA
20-abx915946
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FAH siRNA
20-abx915947
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human FAH shRNA Plasmid
20-abx951521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
FAH Recombinant Protein (Human)
RP011182 100 ug Ask for price
FAH Rabbit pAb
A13492-100ul 100 ul
EUR 308
FAH Rabbit pAb
A13492-200ul 200 ul
EUR 459
FAH Rabbit pAb
A13492-20ul 20 ul
EUR 183
FAH Rabbit pAb
A13492-50ul 50 ul
EUR 223
FAH Blocking Peptide
33R-1054 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPN1 antibody, catalog no. 70R-3618
FAH Blocking Peptide
33R-8429 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAH antibody, catalog no. 70R-2625
FAH Conjugated Antibody
C39026 100ul
EUR 397
FAH cloning plasmid
CSB-CL007965HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1260
  • Sequence: atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacacc
  • Show more
Description: A cloning plasmid for the FAH gene.
FAH Rabbit pAb
A6586-100ul 100 ul
EUR 308
FAH Rabbit pAb
A6586-200ul 200 ul
EUR 459
FAH Rabbit pAb
A6586-20ul 20 ul
EUR 183
FAH Rabbit pAb
A6586-50ul 50 ul
EUR 223
FAH Polyclonal Antibody
A62538 100 µg
EUR 570.55
Description: reagents widely cited
FAH Rabbit pAb
A3238-100ul 100 ul
EUR 384
FAH Rabbit pAb
A3238-200ul 200 ul Ask for price
FAH Rabbit pAb
A3238-20ul 20 ul Ask for price
FAH Rabbit pAb
A3238-50ul 50 ul
EUR 265
anti- FAH antibody
FNab02948 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: fumarylacetoacetate hydrolase (fumarylacetoacetase)
  • Uniprot ID: P16930
  • Gene ID: 2184
  • Research Area: Metabolism
Description: Antibody raised against FAH
Anti-FAH antibody
PAab02948 100 ug
EUR 355
Anti-FAH antibody
STJ28669 100 µl
EUR 277
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).
Anti-FAH antibody
STJ115453 100 µl
EUR 277
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit