Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

To Order Contact us below: zachary@wildpalm.net

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
4-SEJ123Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
  • Fumarylacetoacetase
  • Tyrosinemia 1
  • Beta-diketonase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx026534-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx026534-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx005052
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx018095-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx018096-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx102858
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx102859
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx112607
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx036126-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx317985
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
abx232948-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx002320
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Fumarylacetoacetate Hydrolase (FAH)
4-RPJ123Hu01
  • EUR 517.54
  • EUR 241.00
  • EUR 1665.76
  • EUR 621.92
  • EUR 1143.84
  • EUR 409.00
  • EUR 4014.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16930
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli
Recombinant Fumarylacetoacetate Hydrolase (FAH)
4-RPJ123Hu02
  • EUR 517.54
  • EUR 241.00
  • EUR 1665.76
  • EUR 621.92
  • EUR 1143.84
  • EUR 409.00
  • EUR 4014.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16930
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli
Mouse Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
20-abx389353
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Fumarylacetoacetate Hydrolase (FAH) Protein
20-abx066699
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Human Fumarylacetoacetate Hydrolase (FAH) Protein
20-abx066700
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Human Fumarylacetoacetate Hydrolase (FAH) CLIA Kit
20-abx495621
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase)
ELK4894 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)
20-abx272420
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody (HRP)
20-abx303802
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody (FITC)
20-abx303803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)
20-abx303804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human)
4-PAJ123Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH)
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC
4-PAJ123Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Biotinylated
4-PAJ123Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Cy3
4-PAJ123Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), FITC
4-PAJ123Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), HRP
4-PAJ123Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), PE
4-PAJ123Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat)
4-PAJ123Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH)
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC-Cy7
4-PAJ123Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Val189~Ser419)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAJ123Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAJ123Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAJ123Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAJ123Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAJ123Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAJ123Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.
Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAJ123Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAH (Ile40~Leu195)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.
Anti-Fumarylacetoacetate hydrolase (3G2)
YF-MA12951 100 ug
EUR 363
Description: Mouse monoclonal to Fumarylacetoacetate hydrolase
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02743 5µg Ask for price
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02744 20µg Ask for price
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02745 1mg Ask for price
Fumarylacetoacetate Hydrolase Domain Containing 1 (Recombinant)
20-abx073193
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Fah/ Rat Fah ELISA Kit
ELI-47608r 96 Tests
EUR 886
FAH ELISA KIT|Human
EF009501 96 Tests
EUR 689
FAHD1 Fumarylacetoacetate Hydrolase Domain Containing 1 Human Recombinant Protein
PROTQ6P587 Regular: 20ug
EUR 317
Description: FAHD1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27kDa. The FAHD1 is purified by proprietary chromatographic techniques.
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody
abx030304-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody
abx030304-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2A (FAHD2A) Antibody
20-abx308897
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Fumarylacetoacetase, FAH ELISA KIT
ELI-09815h 96 Tests
EUR 824
Mouse Fah/ Fumarylacetoacetase ELISA Kit
E0499Mo 1 Kit
EUR 632
Mouse Fumarylacetoacetase, Fah ELISA KIT
ELI-32960m 96 Tests
EUR 865
Bovine Fumarylacetoacetase, FAH ELISA KIT
ELI-38504b 96 Tests
EUR 928
Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit
EF014986 96 Tests
EUR 689
FAH ELISA Kit| Bovine Fumarylacetoacetase ELISA Kit
EF011403 96 Tests
EUR 689
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
FAH antibody
70R-17200 50 ul
EUR 435
Description: Rabbit polyclonal FAH antibody
FAH antibody
70R-1062 100 ug
EUR 377
Description: Rabbit polyclonal FAH antibody
FAH antibody
70R-2625 50 ug
EUR 467
Description: Rabbit polyclonal FAH antibody
FAH antibody
39026-100ul 100ul
EUR 252
FAH Antibody
39846-100ul 100ul
EUR 390
FAH Antibody
1-CSB-PA007965GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
FAH Antibody
1-CSB-PA007965LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
FAH siRNA
20-abx901829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FAH siRNA
20-abx915946
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FAH siRNA
20-abx915947
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human FAH shRNA Plasmid
20-abx951521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
FAH Recombinant Protein (Human)
RP011182 100 ug Ask for price
FAH Rabbit pAb
A13492-100ul 100 ul
EUR 308
FAH Rabbit pAb
A13492-200ul 200 ul
EUR 459
FAH Rabbit pAb
A13492-20ul 20 ul
EUR 183
FAH Rabbit pAb
A13492-50ul 50 ul
EUR 223
FAH Blocking Peptide
33R-1054 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPN1 antibody, catalog no. 70R-3618
FAH Blocking Peptide
33R-8429 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAH antibody, catalog no. 70R-2625
FAH Conjugated Antibody
C39026 100ul
EUR 397
FAH cloning plasmid
CSB-CL007965HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1260
  • Sequence: atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacacc
  • Show more
Description: A cloning plasmid for the FAH gene.
FAH Rabbit pAb
A6586-100ul 100 ul
EUR 308
FAH Rabbit pAb
A6586-200ul 200 ul
EUR 459
FAH Rabbit pAb
A6586-20ul 20 ul
EUR 183
FAH Rabbit pAb
A6586-50ul 50 ul
EUR 223
FAH Polyclonal Antibody
A62538 100 µg
EUR 570.55
Description: reagents widely cited
FAH Rabbit pAb
A3238-100ul 100 ul
EUR 384
FAH Rabbit pAb
A3238-200ul 200 ul Ask for price
FAH Rabbit pAb
A3238-20ul 20 ul Ask for price
FAH Rabbit pAb
A3238-50ul 50 ul
EUR 265
anti- FAH antibody
FNab02948 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: fumarylacetoacetate hydrolase (fumarylacetoacetase)
  • Uniprot ID: P16930
  • Gene ID: 2184
  • Research Area: Metabolism
Description: Antibody raised against FAH
Anti-FAH antibody
PAab02948 100 ug
EUR 355
Anti-FAH antibody
STJ28669 100 µl
EUR 277
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).
Anti-FAH antibody
STJ115453 100 µl
EUR 277
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).
Anti-FAH antibody
STJ23615 100 µl
EUR 393
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).
FAH ORF Vector (Human) (pORF)
ORF003728 1.0 ug DNA
EUR 95
Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit
201-12-2818 96 tests
EUR 440
  • This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
DLR-AOAH-Hu-48T 48T
EUR 517
  • Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
DLR-AOAH-Hu-96T 96T
EUR 673
  • Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
DLR-BLMH-Hu-48T 48T
EUR 517
  • Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
DLR-BLMH-Hu-96T 96T
EUR 673
  • Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human γ Glutamate Hydrolase ELISA kit
E01G0559-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human γ Glutamate Hydrolase ELISA kit
E01G0559-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human γ Glutamate Hydrolase ELISA kit
E01G0559-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
20-abx150541
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
20-abx150813
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit
abx252611-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit
EH3210 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q16775
  • Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Valacyclovir hydrolase, BPHL ELISA KIT
ELI-11153h 96 Tests
EUR 824
Human Acyloxyacyl hydrolase(AOAH) ELISA kit
CSB-EL001853HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Acyloxyacyl hydrolase(AOAH) ELISA kit
1-CSB-EL001853HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Bleomycin hydrolase(BLMH) ELISA kit
CSB-EL002716HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Bleomycin hydrolase(BLMH) ELISA kit
1-CSB-EL002716HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Valacyclovir Hydrolase (BPHL) ELISA Kit
20-abx386067
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Acyloxyacyl hydrolase, AOAH ELISA KIT
ELI-34429h 96 Tests
EUR 824
Human Bleomycin hydrolase, BLMH ELISA KIT
ELI-50039h 96 Tests
EUR 824
Human Acyloxyacyl Hydrolase(AOAH)ELISA Kit
QY-E00892 96T
EUR 361
Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit
QY-E01881 96T
EUR 361
Human Bleomycin Hydrolase ELISA Kit (BLMH)
RK00979 96 Tests
EUR 521
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-48Tests 48 Tests
EUR 544
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-96Tests 96 Tests
EUR 756
Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-48Tests 48 Tests
EUR 544
Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-96Tests 96 Tests
EUR 756
Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.
Human Bleomycin Hydrolase (BLMH) ELISA Kit
4-SEC220Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH
  • BMH
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-48Tests 48 Tests
EUR 521
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-96Tests 96 Tests
EUR 723
Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-48Tests 48 Tests
EUR 521
Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-96Tests 96 Tests
EUR 723
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit